ID: 1132102033

View in Genome Browser
Species Human (GRCh38)
Location 15:99030666-99030688
Sequence AGCACTGATGAATGTACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132102033 Original CRISPR AGCACTGATGAATGTACCCA CGG Intergenic
912963814 1:114219517-114219539 AGCACGGATGAATCTACAAAGGG - Intergenic
914807422 1:151001826-151001848 AGCACTGAAGGAAGAACCCATGG + Intronic
915793401 1:158700458-158700480 AGCACTGATAAAAGTATACATGG + Exonic
916536985 1:165712643-165712665 AGCAATGAGGAAACTACCCAGGG + Intergenic
917518232 1:175726268-175726290 AGCACTGCTGAATGTAACATAGG - Intronic
919703388 1:200653914-200653936 AGCTGTGATAAATGTACACAAGG - Intronic
921845113 1:219870622-219870644 AGCCCTGATTAATGCAACCAAGG - Intronic
922163006 1:223092150-223092172 GACACTGATGACTGTTCCCAGGG + Intergenic
1063518329 10:6718360-6718382 TGCACTGAAAAATGGACCCAGGG + Intergenic
1063530569 10:6826940-6826962 AGCATTGATGATTGTATCAACGG - Intergenic
1064686930 10:17872282-17872304 AGCACAGATAAATGTGCCAAAGG + Intronic
1065586262 10:27220407-27220429 AGCTCTGATGTATTTACCCTCGG - Intronic
1066343255 10:34557046-34557068 AGCAATGTTCAATGGACCCAGGG + Intronic
1069980039 10:72246069-72246091 AACCATGATGAATGTTCCCAGGG - Intergenic
1075020101 10:118945739-118945761 AGAACTGAGCAAAGTACCCAGGG + Intergenic
1077570896 11:3337945-3337967 AGCACAGGTGAAGGGACCCAGGG - Intergenic
1080386752 11:31814940-31814962 AGGACTGAGGACTGAACCCAGGG - Intronic
1084724035 11:70928737-70928759 AGCACTGATAAAGGTGCCTAGGG + Intronic
1085755812 11:79200427-79200449 AGCACTGATGAAGGAACCTATGG - Intronic
1089008049 11:115108935-115108957 AGCACTGGAGAATGAACTCAAGG + Intergenic
1089115453 11:116091462-116091484 AGCCCTGCTGCATGTGCCCAAGG + Intergenic
1090228914 11:125088012-125088034 AGCAATGATGAAGGGACCCTGGG + Intronic
1090778645 11:129986904-129986926 AGCACTGTTGAGTGTTCCTATGG - Intronic
1098065097 12:66605968-66605990 AGCACAGATGATTCTTCCCAGGG + Intronic
1100037676 12:90273088-90273110 AGCATTGATCCATGTGCCCAGGG + Intergenic
1101833699 12:108280009-108280031 AGCACAGATGAATGTCTTCAAGG - Intergenic
1105288643 13:19030200-19030222 AGCCCTGATGGAGGTGCCCAAGG - Intergenic
1109079004 13:57874406-57874428 AGCACTGGTGAATATAGTCATGG - Intergenic
1111823491 13:93242211-93242233 AGCCCTGATGGATGTAGCCTAGG + Intronic
1112705437 13:102063077-102063099 AGCACTGATCTATATACCCTTGG - Intronic
1115312693 14:31995391-31995413 AGCACAGGTGAATGGACCCAGGG + Intergenic
1115987239 14:39114521-39114543 AGCACCGAGGGCTGTACCCAGGG - Intronic
1116141743 14:41004950-41004972 AGCTCTGATGAATATATTCAAGG + Intergenic
1117680885 14:58201487-58201509 AGCACTGATGCAAGTAAACATGG + Intronic
1119791358 14:77352883-77352905 AGCTCAGATCAATGTACCCAAGG + Intronic
1122897595 14:104768126-104768148 AGCATTGCTGAAAGTAACCAAGG - Intronic
1125358504 15:38841351-38841373 AGCAATGATGAAAGTATACATGG - Intergenic
1126535325 15:49755880-49755902 AGAACAGATAAATGTACCTAAGG + Intergenic
1127924106 15:63521651-63521673 AGCACTGATGAGTGTGTACAAGG - Intronic
1129073071 15:72967976-72967998 AACACTGCTGTAGGTACCCAGGG + Intergenic
1132102033 15:99030666-99030688 AGCACTGATGAATGTACCCACGG + Intergenic
1133298918 16:4769775-4769797 AGCACTGTTGAATGTGCTCCAGG - Intergenic
1138016571 16:53434247-53434269 AGCCCTGTTGAATGTTCTCACGG + Intronic
1138351067 16:56346542-56346564 AGCACTGATAGAGGTCCCCAAGG + Exonic
1139763261 16:69204863-69204885 ACCACTGGTGAATGCACTCATGG + Intronic
1141553520 16:84821679-84821701 ACCACTGGACAATGTACCCAGGG + Intronic
1143271831 17:5681442-5681464 AGCACTGAAGATAGGACCCAGGG + Intergenic
1144274667 17:13653954-13653976 AGCAATGATGAGTGGACCCGGGG + Intergenic
1146560753 17:33867669-33867691 AACACTGCTGCATTTACCCAAGG - Intronic
1149301000 17:55304612-55304634 AGTACTGATGCATGATCCCAGGG + Intronic
1149666928 17:58371438-58371460 AGCACTGATGCAGGCACACATGG - Intronic
1150537892 17:66063259-66063281 AGTAATGATGAATTTAACCAAGG - Intronic
1151983426 17:77527618-77527640 GCCACTGCTGAATGTACCCCCGG - Intergenic
1152034455 17:77863598-77863620 AGGACTGATGAGTGTTCCCCTGG - Intergenic
1152558841 17:81067874-81067896 AGCACTGGTGACAGTACCGAGGG - Intronic
1156219574 18:35038072-35038094 AGCTCTGAGGAATCTACACAGGG - Intronic
1161298271 19:3530715-3530737 TGGAGGGATGAATGTACCCATGG + Intronic
1165431771 19:35776943-35776965 AGTGAGGATGAATGTACCCAGGG + Intronic
1165744028 19:38219860-38219882 AGCATTTCTGAGTGTACCCATGG - Intronic
1167790740 19:51678039-51678061 AGCACAGAGGAATGCAGCCACGG - Intergenic
932451241 2:71812107-71812129 AGCCCTGATGAATGTTGTCAAGG - Intergenic
932451995 2:71817011-71817033 GGGAATGATGATTGTACCCAAGG + Intergenic
932770894 2:74500204-74500226 AGCACAGGTGAATGGACCCGAGG + Intronic
933203343 2:79476819-79476841 AGTACAGATGAGTGTACCCATGG - Intronic
933593010 2:84253445-84253467 AGCACTGATCAATATACAAAAGG - Intergenic
937080024 2:119134261-119134283 AGCACTGATGAAAGAACACACGG + Intergenic
937786761 2:125908492-125908514 AACAGTGTTGAATATACCCAAGG - Intergenic
937895398 2:126973762-126973784 AGCAGTGAGGACTGTACCCCTGG + Intergenic
941622617 2:167795417-167795439 AGCAATGATGACTTTAACCAGGG - Intergenic
942067376 2:172284402-172284424 AGGACTGAGGAATTTCCCCAGGG + Intergenic
1169647211 20:7825757-7825779 GGCACTTATCAATGTCCCCATGG - Intergenic
1177411947 21:20740316-20740338 AGCTTTTATGAAAGTACCCAGGG - Intergenic
1179372698 21:40821467-40821489 AGCACTGATCCATGTTCCCTAGG + Intronic
1181535888 22:23544468-23544490 AGCTCTGATGATTGTATCAACGG + Intergenic
1181843161 22:25682730-25682752 AGCACTGATGAATTTTCATAAGG + Intronic
1182866369 22:33607828-33607850 AGCACTGCAGAATTTCCCCATGG + Intronic
1184079645 22:42210350-42210372 AGCATTGATGATTGTACAAACGG + Exonic
1184368459 22:44067797-44067819 AGCACTAATGCAGGTCCCCAGGG - Intronic
953411712 3:42693917-42693939 AGGAATGTTGAATGCACCCAGGG - Intronic
954637647 3:52079909-52079931 AGGACTTAAGAATGTTCCCAGGG - Intronic
956703354 3:71978498-71978520 TGTACAGATGAATGAACCCAGGG + Intergenic
957039826 3:75328364-75328386 AGCCTTGGTGCATGTACCCAAGG + Intergenic
958152587 3:89709770-89709792 ACCACTGAAGAATGTATCCATGG + Intergenic
961031677 3:123610514-123610536 AGAAGTGATGTATGTACCCTCGG - Intronic
961044577 3:123699798-123699820 AGCCTTGGTGCATGTACCCAAGG + Intronic
961498532 3:127313475-127313497 AGAACTGATGAATAAATCCAAGG - Intergenic
962285758 3:134084572-134084594 AGCACTGATGAGGGTCCCCCAGG - Intronic
964136946 3:153354623-153354645 GGAACTGATGAATTTACCAATGG - Intergenic
964992304 3:162828882-162828904 AGCACTTCTGAATGTACCCTGGG + Intergenic
967002529 3:185350103-185350125 AGCACTTATGAATTGATCCAAGG + Intronic
973336862 4:48965468-48965490 AGGACTGGTGTATCTACCCAAGG + Intergenic
975450881 4:74525170-74525192 ATCACTGATGACTTTTCCCAGGG - Intergenic
976041165 4:80886245-80886267 AGCATTTCTGAATGTGCCCAGGG + Intronic
979790761 4:124778587-124778609 AGAACTGAAGAATGTATGCAAGG - Intergenic
981575928 4:146205440-146205462 AGCTCTGATGAATATATACAAGG + Intergenic
983280408 4:165673922-165673944 TGGACTGATGAATGTGCCTAGGG + Intergenic
984559257 4:181249705-181249727 AGCACTCATCTATGTTCCCATGG - Intergenic
985722714 5:1498362-1498384 AGCACTGATGAAAGCTCCCTTGG - Intronic
986598187 5:9444946-9444968 AGCACTGATGCAAACACCCATGG + Intronic
988669690 5:33367862-33367884 AGCTCTGATGAAGATACACAAGG - Intergenic
992613189 5:78525142-78525164 GACACTGCTGAATGTTCCCAGGG + Intronic
992849582 5:80793525-80793547 AGCATTGAGGAATGTTCCCCAGG + Intronic
995641196 5:114259340-114259362 GGCACTGATGAATGTCTGCAGGG + Intergenic
1003081164 6:3022976-3022998 AGCACTGCTGGCTGTGCCCAGGG + Intergenic
1003476201 6:6485966-6485988 AGCACTGAAGAAAGTTCCGATGG + Intergenic
1004978651 6:20997362-20997384 AACACAGATTAATGTCCCCAAGG - Intronic
1008039790 6:46785103-46785125 AGCACTGATGAATGCTCCTGAGG + Intergenic
1009392182 6:63157364-63157386 AGCACTGTTGTTTGTGCCCAAGG - Intergenic
1009932447 6:70192637-70192659 AATACTGAAGAATATACCCATGG + Intronic
1010726977 6:79346271-79346293 AGCACTGGTGACTGTAAGCAGGG + Intergenic
1013054309 6:106568431-106568453 ATAAAAGATGAATGTACCCATGG - Intronic
1017753334 6:157509195-157509217 AGCACTGATGTGAGTACCCTGGG + Intronic
1021621985 7:22557739-22557761 AGTCCTGAAGAATGTACCTAGGG + Intronic
1028046306 7:86124005-86124027 AGAACTAAAGAATGTACCAATGG + Intergenic
1031129881 7:117820064-117820086 AGCACTAATGAATGTGTGCAAGG - Intronic
1031905739 7:127458134-127458156 AGCACTGATGAATAAGCACAAGG + Intergenic
1033355329 7:140594514-140594536 ATCCCTGCTGAATGTTCCCATGG + Intronic
1035788603 8:2283142-2283164 AGCAACGATGAATGTACCACAGG + Intergenic
1035804202 8:2438563-2438585 AGCAACGATGAATGTACCACAGG - Intergenic
1035991769 8:4499058-4499080 AGCACTGATGAAAGTGCTAAAGG + Intronic
1038869302 8:31476813-31476835 TGTACTGGTGAATTTACCCAGGG - Intergenic
1044200286 8:89427176-89427198 GAGACTGATGAATGTTCCCAGGG - Intergenic
1046882306 8:119322477-119322499 AGCACAGATGGATGTAAACATGG - Intergenic
1048044347 8:130759212-130759234 AGAACTGATGGATGAACACATGG + Intergenic
1048243136 8:132764436-132764458 AGCACTGATGAATTTAATCAGGG - Intergenic
1048318355 8:133378480-133378502 ATCACTGATGACTGTCTCCAGGG - Intergenic
1049346961 8:142144244-142144266 AGTGCTGGTGAATGTGCCCAGGG - Intergenic
1050122826 9:2325444-2325466 GGCACAGAGGAATGTAACCAAGG + Intergenic
1055839883 9:80490790-80490812 TCCACTGATAACTGTACCCAAGG + Intergenic
1057750730 9:97790716-97790738 ATCACTGATCAATGTTCCCATGG - Intergenic
1059498496 9:114730565-114730587 AGTTCTGAGGAGTGTACCCAAGG - Intergenic
1061054757 9:128216561-128216583 AGAAATGATGAATATACACAGGG + Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1187727796 X:22221863-22221885 AGGACTCAAGAATGTTCCCAAGG - Intronic
1189846439 X:45142910-45142932 GGCAGTGATGAATCTACTCAAGG + Intergenic
1192981813 X:76351960-76351982 AGCATTGATGAATGTGCCTGGGG - Intergenic
1193386086 X:80873032-80873054 AGCACTGAAGAAGCTGCCCATGG - Intergenic
1194153653 X:90359620-90359642 AGCATGGCAGAATGTACCCATGG + Intergenic
1194492459 X:94568572-94568594 AGCACTGAAGAGGGTAGCCAGGG - Intergenic
1195170294 X:102260780-102260802 AGCACTGATGCACATCCCCATGG + Intergenic
1195188565 X:102426320-102426342 AGCACTGATGCACATCCCCATGG - Intronic
1198819033 X:140625581-140625603 AGCTCTGATGAAGGTACACCAGG + Intergenic
1198826520 X:140703916-140703938 AGCTCTGATGAAGGTGTCCAAGG - Intergenic
1201552994 Y:15238344-15238366 AGCACTGCTCAATGTTGCCATGG - Intergenic
1201754854 Y:17475899-17475921 AGAAGTGATTAATGTACCTAAGG + Intergenic
1201846698 Y:18430086-18430108 AGAAGTGATTAATGTACCTAAGG - Intergenic