ID: 1132106532

View in Genome Browser
Species Human (GRCh38)
Location 15:99066798-99066820
Sequence CCATTCCCACCAAGCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132106532_1132106538 20 Left 1132106532 15:99066798-99066820 CCTGAGTGGCTTGGTGGGAATGG No data
Right 1132106538 15:99066841-99066863 AGAGTGAGAAGTGAGTGAGGAGG No data
1132106532_1132106537 17 Left 1132106532 15:99066798-99066820 CCTGAGTGGCTTGGTGGGAATGG No data
Right 1132106537 15:99066838-99066860 AGGAGAGTGAGAAGTGAGTGAGG No data
1132106532_1132106534 -3 Left 1132106532 15:99066798-99066820 CCTGAGTGGCTTGGTGGGAATGG No data
Right 1132106534 15:99066818-99066840 TGGAAGAGAGTCAAGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132106532 Original CRISPR CCATTCCCACCAAGCCACTC AGG (reversed) Intergenic
No off target data available for this crispr