ID: 1132112015

View in Genome Browser
Species Human (GRCh38)
Location 15:99108466-99108488
Sequence CCCAAGCCTGTAATTTTTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132112015 Original CRISPR CCCAAGCCTGTAATTTTTTT CGG Intronic
901357063 1:8659648-8659670 CCCAAGCTTTTCATTCTTTTTGG - Intronic
903893994 1:26590527-26590549 ACCTGGCATGTAATTTTTTTGGG + Intergenic
903948995 1:26983181-26983203 CTCACGCCTGTAATTACTTTGGG + Intergenic
904452851 1:30627460-30627482 CCTCAGCCTGTAACTTTTTGCGG - Intergenic
905685132 1:39902184-39902206 CCCCAGCGTGCAATTTATTTGGG - Intronic
909646217 1:77920158-77920180 CTCATGCCTGTAATCATTTTGGG - Intronic
910849710 1:91638110-91638132 CCCTGTACTGTAATTTTTTTCGG + Intergenic
915232805 1:154458365-154458387 GCAAAGCCTGTTATATTTTTTGG + Intronic
918585195 1:186178915-186178937 CTCAAGTCTGTAATAGTTTTAGG - Intronic
918840038 1:189523766-189523788 CACAAGTCTGTGATTTTTTCCGG + Intergenic
919109839 1:193205087-193205109 ACCAACCCTGTATTTATTTTTGG + Intronic
919344498 1:196358026-196358048 CTCAAGCCTGTAAATTGTTAGGG - Intronic
921816369 1:219568663-219568685 TCCCAGCCTGTTATTTGTTTGGG - Intergenic
921967097 1:221101817-221101839 TCCAAACCAGAAATTTTTTTTGG + Intergenic
924546132 1:245029592-245029614 CCCAGCCCTGTTTTTTTTTTTGG + Intronic
1063275942 10:4568099-4568121 CCCAAGCCTCTAATTTATTTTGG + Intergenic
1063575210 10:7255834-7255856 CCCAAACCTGAAACTTTTTGAGG + Intronic
1064311398 10:14214927-14214949 CCCAAGCCTGTTAGATTTATTGG - Intronic
1065791455 10:29264349-29264371 CCCAATCTTGTTATTTTTTATGG - Intergenic
1068386986 10:56343012-56343034 CCCACATCTTTAATTTTTTTTGG - Intergenic
1069091105 10:64199663-64199685 CCTGAGCCTGTGATTTTCTTGGG + Intergenic
1070335261 10:75449480-75449502 GCCAAGCCTGTATTTACTTTTGG + Intronic
1072281163 10:93866589-93866611 GCCAACCCTGTAATTTTAGTAGG - Intergenic
1072351265 10:94559863-94559885 CCCAAGCTTGTATTTTTCCTAGG + Intronic
1072460425 10:95613405-95613427 CCCAAGCATATATTATTTTTTGG - Intronic
1074715040 10:116210712-116210734 ACCAAGCCTGTAAGATTATTTGG + Intronic
1078262332 11:9721730-9721752 CTCAAGCCTGTAATCCCTTTGGG - Intronic
1078362134 11:10677188-10677210 CCCAACCCTGTACTTTTCCTGGG + Intronic
1080487540 11:32726671-32726693 GCCAAGCCTATAATTGATTTTGG - Intronic
1081546717 11:44077176-44077198 TCCAAGCCTTTAACTTCTTTGGG - Intronic
1083020803 11:59504836-59504858 CTCATGCCTGTAATTTTTTTGGG + Intergenic
1084977622 11:72811485-72811507 ACCAAGCCTGGCTTTTTTTTGGG + Intergenic
1086911168 11:92474408-92474430 CCCAAGCCCAGAATTATTTTAGG - Intronic
1087264541 11:96045921-96045943 CCCATTCCTGTTATTGTTTTTGG + Intronic
1089093394 11:115897525-115897547 CACAAGCCTGTAAGCCTTTTGGG - Intergenic
1089234914 11:117015697-117015719 CACATGCCTGTAATTAGTTTGGG - Intronic
1090720193 11:129465542-129465564 CCCCATCTTGTAATTTTTTTTGG + Intergenic
1093811581 12:23498757-23498779 CCCCAGCCTCTGAATTTTTTAGG + Intergenic
1094039501 12:26108157-26108179 CCATAGTCTTTAATTTTTTTTGG - Intergenic
1095243647 12:39891445-39891467 CACAAGCCTCCAATCTTTTTTGG - Intronic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1099092447 12:78330270-78330292 CCATGGCCTGTAATTTTTTATGG + Intergenic
1101641964 12:106592638-106592660 CCCAACCCTCTTATGTTTTTAGG + Intronic
1102921154 12:116792655-116792677 TCCAAGCCTGCAATTTATCTTGG - Intronic
1103120186 12:118373265-118373287 CCCACGCCTTTACTTTTCTTGGG + Intergenic
1103292504 12:119858516-119858538 CCCACGCCTTTTTTTTTTTTTGG - Intronic
1103877174 12:124137168-124137190 CCCAATTCTGGAATTTGTTTAGG - Intronic
1104428084 12:128694475-128694497 CAAAAGCTTCTAATTTTTTTGGG + Intronic
1106669069 13:31885797-31885819 TCTAAGCCTGTAACTTTTTGGGG + Intergenic
1107036750 13:35910184-35910206 CAAAAGCATGTAATTTTTATCGG - Intronic
1108909266 13:55522625-55522647 GCTCAGCCTGTAATTGTTTTAGG - Intergenic
1110924753 13:81137639-81137661 CCCCTACCTGTGATTTTTTTAGG + Intergenic
1111002348 13:82201571-82201593 CAAAAGCCTGAAATTCTTTTTGG - Intergenic
1111322834 13:86651994-86652016 CACATGCCTGTCCTTTTTTTTGG + Intergenic
1113425452 13:110204415-110204437 CCCTTGGCTGTAATTTTTTGAGG - Intronic
1114776784 14:25493056-25493078 CTCAAGCCTGTAATCCCTTTGGG + Intergenic
1115129630 14:30039318-30039340 CCAAAGTCTGTAATTTGTCTTGG - Intronic
1116482694 14:45410945-45410967 CCTAAGTATTTAATTTTTTTTGG + Intergenic
1116934940 14:50730157-50730179 CCCAAGTTAGCAATTTTTTTTGG + Intronic
1117770272 14:59127174-59127196 CTCCAGCTTGTACTTTTTTTTGG - Intergenic
1120472803 14:84947994-84948016 CCAAAAACTGTAATTTTTTTTGG + Intergenic
1120706943 14:87755129-87755151 CCCTACCCTGTAATTGTTTTGGG - Intergenic
1123487235 15:20752543-20752565 CCCAATTCTGTAATTTTCTATGG - Intergenic
1123543725 15:21321598-21321620 CCCAATTCTGTAATTTTCTATGG - Intergenic
1123633153 15:22275615-22275637 CCCAAGCTTTTTATTCTTTTTGG + Intergenic
1125898036 15:43319044-43319066 CAAAAGCTTGTGATTTTTTTTGG + Intergenic
1126149373 15:45508620-45508642 CCCAATCATGTAATTCTCTTTGG + Intronic
1126373733 15:47974031-47974053 CACAAGCCTGGAAGTTATTTTGG + Intergenic
1127816100 15:62610303-62610325 CCCAAGCCTGTATTTCTCCTAGG - Intronic
1130538812 15:84806331-84806353 CCCAAGTATGGGATTTTTTTGGG + Exonic
1132112015 15:99108466-99108488 CCCAAGCCTGTAATTTTTTTCGG + Intronic
1132134794 15:99325165-99325187 ACCAAGTATATAATTTTTTTTGG + Intronic
1202952042 15_KI270727v1_random:48724-48746 CCCAATTCTGTAATTTTCTATGG - Intergenic
1134363883 16:13558445-13558467 CCCAACCCTGTATTTCTCTTAGG - Intergenic
1134836535 16:17365977-17365999 CTCAAGCCTCTAATCTTTTCAGG - Intronic
1136988645 16:35138339-35138361 CCCATACCTGTAATTATTTTGGG + Intergenic
1137556237 16:49472199-49472221 CACCAGCCTGTAATCTCTTTGGG + Intergenic
1139029696 16:62863967-62863989 CCCACACCTGTAATTTTCTTTGG - Intergenic
1139229745 16:65272253-65272275 CACAAGCCTCTAATTTTCTGTGG - Intergenic
1140041194 16:71409331-71409353 CACAAGCTTGGAATGTTTTTGGG - Intergenic
1141930771 16:87201246-87201268 CCAAAGCCTGTACATTTTTCAGG + Intronic
1147903628 17:43807958-43807980 GCCCAGCCTTTTATTTTTTTGGG - Intronic
1149626895 17:58085799-58085821 CCCAAGCCTCTGTTTTTTTAGGG + Intronic
1150122227 17:62613708-62613730 CCCAAGCCTCTGAATTTTGTGGG + Intronic
1151258888 17:72901348-72901370 CCCACGCCTCTAATTGTCTTAGG - Intronic
1151265567 17:72952557-72952579 GCCAAGGCTGTATTTATTTTAGG - Intronic
1151838309 17:76598951-76598973 CTCATGCCTGTAATCTCTTTGGG - Intergenic
1153323954 18:3799132-3799154 CTCACGCCTGTAATCTCTTTAGG - Intronic
1154071287 18:11154222-11154244 AAAAAACCTGTAATTTTTTTTGG - Intergenic
1155085359 18:22452764-22452786 GCCAAGCTTGTTATTTTCTTAGG + Intergenic
1155525392 18:26710982-26711004 CCCCAGTATGTAATTTGTTTGGG - Intergenic
1157791581 18:50536410-50536432 TCAAAGCCTGTAATTCTTTTAGG - Intergenic
1158585421 18:58729186-58729208 CCCAGGACTGTAATTTTCTTAGG - Intronic
1159660340 18:71088409-71088431 AACTATCCTGTAATTTTTTTCGG - Intergenic
1159694188 18:71533459-71533481 CCCTACCTTGTAATTTTTTAAGG - Intergenic
1159825194 18:73199973-73199995 CCCATGCCTGAAATATTTCTTGG - Intronic
1161225812 19:3145151-3145173 CCCTAGTTTTTAATTTTTTTTGG + Intronic
1161558113 19:4955794-4955816 ACCATGCCTCTAAATTTTTTTGG + Intronic
1162904721 19:13816948-13816970 CCCATGCCTGTAATCCCTTTGGG + Intronic
1164872686 19:31659405-31659427 CCCATGCCTCTTATATTTTTAGG - Intergenic
1165678069 19:37745380-37745402 GCCAAGACTTTAATTTTTTTGGG + Intronic
1166859128 19:45799676-45799698 CCCAAGCTTGCCATTCTTTTTGG + Intronic
928789956 2:34938460-34938482 CCCAGCCCTATAATTTTTCTTGG + Intergenic
930475994 2:51882701-51882723 CTCAAGCCTGTAATCCCTTTGGG - Intergenic
930676911 2:54212192-54212214 CCCAAGCTTTTATTTATTTTGGG + Intronic
930804974 2:55481019-55481041 CTCACGCCTGTAATTCCTTTGGG - Intergenic
932731260 2:74223641-74223663 CCCAACCCTGTAATAGTTCTTGG + Intronic
933108726 2:78369561-78369583 GCCAAACTTGTAATTTTTTCTGG + Intergenic
933190644 2:79329958-79329980 CTGAAGCCTGTCATGTTTTTGGG - Intronic
936026837 2:109037712-109037734 CCCAAGTATATAATTTTCTTTGG - Intergenic
936644642 2:114354897-114354919 CCCAAGCTTGAATTTTCTTTGGG + Intergenic
937085968 2:119172032-119172054 CCCATGCCTGTAATCCCTTTGGG + Intergenic
937559182 2:123199969-123199991 CCCAAACCAATAATTTTTCTTGG - Intergenic
937588441 2:123585206-123585228 CCCAAGTCTTTCATTTTTGTAGG - Intergenic
941373184 2:164693208-164693230 ACAAAGCCTGTGATTTTTCTTGG - Intronic
942809288 2:179977724-179977746 CACATGCCTGTCATTTTTTGTGG - Intronic
943480122 2:188406404-188406426 CACATGACTGTAATTGTTTTAGG + Intronic
944295286 2:198054539-198054561 CCCATCTCTGTAACTTTTTTGGG + Intronic
945217563 2:207450818-207450840 CCAAAGCCAGTAAGTGTTTTTGG - Intergenic
946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG + Intergenic
946444133 2:219723628-219723650 CCCCAGCCTGTACCTTGTTTGGG + Intergenic
946950571 2:224870303-224870325 CCCAAGACTGTAATTTATAAAGG - Intronic
947561210 2:231154128-231154150 CAACAGCCTGTACTTTTTTTTGG - Intronic
1170123085 20:12932582-12932604 ACCAATCCTGTAATTATCTTAGG - Intergenic
1170498752 20:16952762-16952784 CCCAAGCCTGAAATAATTCTTGG + Intergenic
1177615483 21:23512370-23512392 CTCATGCCTGTAATTACTTTGGG + Intergenic
1177709666 21:24756679-24756701 CTTTTGCCTGTAATTTTTTTGGG + Intergenic
1178251755 21:31010032-31010054 ACCCAGCCTGTAAATTTTCTCGG - Intergenic
1179808586 21:43855697-43855719 CCCAGCCTTGAAATTTTTTTGGG + Intergenic
1182668826 22:31978716-31978738 ACTAATCCTATAATTTTTTTTGG + Intergenic
1184592540 22:45494681-45494703 CCCAAGACTGTAATTTATAAAGG + Intergenic
1185008176 22:48298024-48298046 GCTAAGCCTGAAATTTTGTTTGG + Intergenic
1185353326 22:50349856-50349878 CCCACGCCTGTAATCAGTTTGGG + Intronic
949275440 3:2274443-2274465 CTCAAATCTGTAATTGTTTTAGG + Intronic
949285607 3:2400031-2400053 CCCAAGCCCGTAATTAGTCTTGG - Intronic
950390920 3:12696187-12696209 CCAAAGCCTGTGATTTTCTAAGG + Intergenic
951673006 3:25205588-25205610 CTCAAGCATTTATTTTTTTTGGG - Intronic
953950497 3:47185840-47185862 CCCAACCCAGTAAAATTTTTAGG - Intergenic
954346114 3:50000975-50000997 CCTAAGCCTGTCATTCTTTAAGG - Intronic
954563558 3:51579251-51579273 CTCAAGCCTGGGATTTTTATGGG + Intronic
955475816 3:59334863-59334885 CCCATGCCTGTAATTCATTTAGG - Intergenic
956056960 3:65309888-65309910 CCCAAGCCTGTAATTGCTTGAGG + Intergenic
956059729 3:65337267-65337289 CCCAGGAGTGTAACTTTTTTTGG - Intergenic
959927734 3:111942959-111942981 CCCAACCCTGTATTGTTTTAGGG + Intronic
960505028 3:118482377-118482399 CAGAATCCTTTAATTTTTTTTGG + Intergenic
962469858 3:135696975-135696997 CCCAAGTCTGTGAATTTTGTTGG + Intergenic
963491008 3:146000118-146000140 CCCAAGCATCTACTTTCTTTGGG - Intergenic
963727888 3:148942166-148942188 CTCAAGCCTTTAACTTTTCTGGG + Intergenic
964183921 3:153919928-153919950 CCCAAGACTGTAGTTTCTCTTGG + Intergenic
965222664 3:165947187-165947209 CTCACGCCTGTAATCTCTTTGGG + Intergenic
966234209 3:177682710-177682732 CCCCTCCCTGTACTTTTTTTTGG + Intergenic
967417109 3:189231364-189231386 CTCAAGCCTATAATAGTTTTCGG - Intronic
967962574 3:194937827-194937849 CTCAGGCCTTTAATTTCTTTTGG - Intergenic
970224718 4:13845701-13845723 CCCAAAATTGTGATTTTTTTTGG - Intergenic
970271475 4:14352590-14352612 CTGAAGCCTGTAAATTTCTTAGG - Intergenic
970859036 4:20681153-20681175 CCCAAGCAGGTCAATTTTTTAGG + Intergenic
971470946 4:27026574-27026596 CTCTTGCCTGTAATTTTTTGGGG - Intergenic
972089626 4:35265046-35265068 CCCAAAACTCTAATTTTTGTGGG + Intergenic
972152573 4:36112259-36112281 CCCTAGACTATACTTTTTTTAGG - Intronic
973669762 4:53204324-53204346 TTCAAGGATGTAATTTTTTTTGG - Intronic
974070503 4:57119165-57119187 CCCAAGCCTCTGTTTTCTTTAGG + Intergenic
974321370 4:60354228-60354250 CCCAAGCCTCTGAATTTTGTGGG - Intergenic
974610781 4:64213058-64213080 CTCAAGTCTGTCATTTTGTTTGG + Intergenic
976290903 4:83416235-83416257 ACCATGCCTGGCATTTTTTTTGG + Intronic
976584672 4:86782007-86782029 TCCAAACCTCTAATATTTTTGGG - Intronic
977914949 4:102581492-102581514 GCCTGGCCTGTAAATTTTTTTGG - Intronic
979604058 4:122618378-122618400 CCAATGCCTGTAATCCTTTTGGG - Intronic
980656235 4:135790749-135790771 CCCTATACTGTAATTCTTTTTGG + Intergenic
982191421 4:152859494-152859516 CCCAAGCTTGTAGTCTTTTGAGG + Intronic
982533949 4:156585163-156585185 CCAAAGCCTGTAAATTTTTTTGG + Intergenic
983192051 4:164765069-164765091 TCCAAACCTGAAATTTTATTTGG + Intergenic
983343097 4:166491395-166491417 CCCAAGTGAGTAAGTTTTTTGGG - Intergenic
983356898 4:166673716-166673738 CCAAAGCCAGTAATTTTTATAGG - Intergenic
987109802 5:14674858-14674880 CCCAGGCCTGTCAGTTCTTTAGG - Intronic
988171545 5:27663534-27663556 TCCAAGCCACTAATTTTTCTTGG + Intergenic
988635074 5:32974487-32974509 CCCAAGCATTTCATTTTTTTTGG + Intergenic
990450370 5:55927602-55927624 CCCAGGCCAGTGAGTTTTTTTGG - Intergenic
990647594 5:57861863-57861885 CCCAATGCTGTAATGTTTATTGG + Intergenic
995087939 5:108137301-108137323 GCCAAGGCTGTATTTTTTGTAGG + Intronic
995480020 5:112584169-112584191 TGCATGCCTGTAATCTTTTTGGG - Intergenic
996082019 5:119267722-119267744 CCCAAACGTGTAACTTTCTTTGG + Intergenic
996450034 5:123610574-123610596 CACAAGCCTGTATGTGTTTTAGG + Intronic
996935813 5:128947002-128947024 CACATGCCTGTAATTTATTTTGG - Intronic
1000435723 5:161205910-161205932 CACAAGCCTTGAATATTTTTAGG - Intergenic
1001423177 5:171602289-171602311 CCCAAGACTGTTAGTTCTTTAGG - Intergenic
1002976431 6:2082453-2082475 CCCATGCCTGCAATTTTATGAGG - Intronic
1004816767 6:19319478-19319500 CCCAAGCCTCTGATTTCTTTGGG + Intergenic
1005760676 6:28964944-28964966 CCCATGCCTGCAATCTCTTTGGG + Intergenic
1007134376 6:39507460-39507482 CCTAATCTGGTAATTTTTTTTGG + Intronic
1007405247 6:41631855-41631877 CTCAAGTCTGTAGGTTTTTTAGG - Intergenic
1008500243 6:52174003-52174025 CCCCTGCCTGAAATTATTTTAGG + Intergenic
1010567657 6:77436489-77436511 CCAAAACCTTTAATTTTTTAAGG - Intergenic
1010858056 6:80868270-80868292 CACATGCTTGTATTTTTTTTGGG + Intergenic
1015341201 6:132103045-132103067 CCCAAACCTGTCATTTCTCTTGG - Intergenic
1015384160 6:132603041-132603063 CTCAAGCCTGTAATCACTTTGGG + Intergenic
1015782633 6:136885697-136885719 CCTAAGCCTGTCAGTTTTGTTGG + Intronic
1016080650 6:139851204-139851226 CCCAACCCTGTAATTCTACTGGG - Intergenic
1018830344 6:167437898-167437920 CACAATGCTGTAATATTTTTTGG - Intergenic
1019866770 7:3719108-3719130 CCCAAGTCTGTATTTCATTTGGG + Intronic
1020168853 7:5829097-5829119 ACCAAGCCTGTATGTTTTTTAGG - Intergenic
1022090502 7:27104920-27104942 CTTAAGCCTGTAATATTTTCTGG - Intergenic
1022333428 7:29401007-29401029 CTCATGCCTGTAATCTCTTTGGG + Intronic
1023124575 7:36942763-36942785 CCCTAGCCAGGAAATTTTTTAGG + Intronic
1024582443 7:50810765-50810787 CCCAGGCCTGTGACTTTGTTGGG + Intergenic
1025069458 7:55886414-55886436 CCAAAGAATGGAATTTTTTTAGG - Intergenic
1028737213 7:94229888-94229910 ATCAAGTCTGAAATTTTTTTTGG + Intergenic
1029746910 7:102520867-102520889 CCCAACTCTGTAATATATTTTGG + Intergenic
1030717688 7:112829557-112829579 TGCATGGCTGTAATTTTTTTTGG + Intronic
1031641867 7:124174316-124174338 CCGGATCCTGGAATTTTTTTTGG + Intergenic
1036480903 8:9138876-9138898 CCCAAACCTGTGATTTTTCTTGG - Exonic
1036531426 8:9592234-9592256 CCCAATACTTAAATTTTTTTTGG + Intronic
1037400756 8:18493269-18493291 CCCAAGACAGAAATTTATTTAGG - Intergenic
1039976380 8:42369667-42369689 CCCAACCTTGTAATTTGTTTAGG - Intronic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1042395059 8:68282319-68282341 CCCTAGCTTGTACTTGTTTTGGG + Intergenic
1043293163 8:78629342-78629364 CTCAAGCCTGTGGATTTTTTGGG - Intergenic
1043612848 8:82087365-82087387 CACAAGTCTGAAATTTTTTTAGG - Intergenic
1044562229 8:93624198-93624220 CCCATGCCTTGTATTTTTTTTGG - Intergenic
1044654754 8:94535848-94535870 CAAAAGCCTTTAATCTTTTTAGG - Intronic
1048046672 8:130779380-130779402 CCAAATCCTTTAATTTTTCTGGG + Intergenic
1055506951 9:76957789-76957811 CCCTAGCCTGTAATCTCTTGAGG - Intergenic
1055924914 9:81499962-81499984 CCCAGGCCCATAATTTTTTTAGG + Intergenic
1056143941 9:83710786-83710808 CCAAAGCTTTTTATTTTTTTTGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058376457 9:104327669-104327691 TCCATGCCTGTAGTTTTGTTTGG - Intergenic
1058427230 9:104885472-104885494 CCCAAGCCTGTGTGTTTTTCAGG - Intronic
1059087057 9:111315624-111315646 CTCACGCCTGTAATCTCTTTGGG + Intergenic
1059645259 9:116259621-116259643 GCCAAATATGTAATTTTTTTTGG - Intronic
1187516099 X:19972378-19972400 CCAAAGGTGGTAATTTTTTTGGG + Intergenic
1189085167 X:38015268-38015290 GCGAAGCATGTAATTATTTTTGG + Intronic
1190015653 X:46824655-46824677 GCCCAGCCTGGAATTCTTTTTGG + Intergenic
1190485688 X:50922619-50922641 CCCATGCCTTTTATTTTTTGAGG - Intergenic
1191792350 X:64984376-64984398 CCCTAGCCTCTAAATTTTTACGG - Intronic
1193200617 X:78686045-78686067 GCAAATCCTGTAATTTTTCTGGG + Intergenic
1193765010 X:85517369-85517391 CCCAAGATTGTAATTTTTGTGGG - Intergenic
1194904593 X:99558741-99558763 CCCAAGGCTATTATTTTTGTTGG + Intergenic
1195457506 X:105085101-105085123 CCCAAGCCTGTAATTTATAAAGG - Intronic
1195885038 X:109629018-109629040 CCCACACCTGTTGTTTTTTTTGG - Intronic
1196191886 X:112803362-112803384 CCCCATCCTGTAATTTTCTCTGG + Intronic
1196372178 X:114991647-114991669 CCAAAGCCTGGAATATTCTTGGG + Intergenic
1197799821 X:130337651-130337673 CTCCAGCCTCAAATTTTTTTTGG - Intergenic
1201666247 Y:16459327-16459349 ACCAAGCCTTTTTTTTTTTTTGG + Intergenic
1201757906 Y:17507686-17507708 CAAATGCCTGTAATTGTTTTAGG + Intergenic
1201843649 Y:18398296-18398318 CAAATGCCTGTAATTGTTTTAGG - Intergenic