ID: 1132112239

View in Genome Browser
Species Human (GRCh38)
Location 15:99110058-99110080
Sequence GCTTGGACCAGGGGTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132112234_1132112239 -3 Left 1132112234 15:99110038-99110060 CCAGGCAGGAAGTGCTCGAGGCT 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1132112239 15:99110058-99110080 GCTTGGACCAGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1132112229_1132112239 20 Left 1132112229 15:99110015-99110037 CCTTCAGAGATTGTTGCAGTAAC 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1132112239 15:99110058-99110080 GCTTGGACCAGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 170
1132112233_1132112239 -2 Left 1132112233 15:99110037-99110059 CCCAGGCAGGAAGTGCTCGAGGC 0: 1
1: 0
2: 0
3: 21
4: 309
Right 1132112239 15:99110058-99110080 GCTTGGACCAGGGGTCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132112239 Original CRISPR GCTTGGACCAGGGGTCTCAG AGG Intronic