ID: 1132113838

View in Genome Browser
Species Human (GRCh38)
Location 15:99121258-99121280
Sequence CAGGGCCAGCACTGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132113838 Original CRISPR CAGGGCCAGCACTGTGGAGG GGG Intronic
900360141 1:2284369-2284391 CTGGGTCAGCACAGTAGAGGCGG + Intronic
900436675 1:2634337-2634359 CAGGGCCAGCCTTGGGGAGTCGG - Intergenic
900618828 1:3577770-3577792 CCAGGCCAGCACTGCGGAGTGGG - Intronic
900643535 1:3698509-3698531 GTGGGCCAGCCCTCTGGAGGAGG + Intronic
900976515 1:6020161-6020183 CTGGGCCAGGACTGTGGGGAGGG - Intronic
900987012 1:6078976-6078998 CAGGGTGGGCACCGTGGAGGTGG + Intronic
901327296 1:8374881-8374903 CAGGGCCTGGACAGAGGAGGAGG - Intronic
901645427 1:10714554-10714576 CACGGCCAGCCCAGTGGTGGTGG - Intronic
901815375 1:11790611-11790633 GAGAAGCAGCACTGTGGAGGAGG + Exonic
902401931 1:16162600-16162622 CTGGGTCCGCACTGGGGAGGCGG + Intergenic
902553243 1:17231575-17231597 CAGGGCCAGCGTGCTGGAGGGGG + Intronic
904405408 1:30285207-30285229 CCGGGACTGCACAGTGGAGGGGG - Intergenic
904467176 1:30715099-30715121 CAGGTGGGGCACTGTGGAGGTGG - Intronic
904757064 1:32773757-32773779 CTGAGCAAGCACTGAGGAGGTGG + Exonic
905313634 1:37067504-37067526 CAGTGTCAGGACTGTGAAGGTGG - Intergenic
905483586 1:38279537-38279559 CAGGGACACCATTGAGGAGGTGG - Intergenic
905501790 1:38445387-38445409 CAGTGGCAGCAGTGTGGTGGAGG - Intergenic
905632077 1:39524555-39524577 CAGGGCCAGCAGGGAGGAGAGGG + Intronic
905805729 1:40875901-40875923 CAGCAGCAGCAATGTGGAGGAGG - Intergenic
906322108 1:44823281-44823303 CAGACCCAGCAATGTGGAGATGG + Exonic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907431840 1:54416738-54416760 GAGGGCCAGCATTCTAGAGGGGG - Intergenic
908319729 1:62967620-62967642 CCGGGCCGGCACAGTGGACGAGG - Intergenic
912393892 1:109324704-109324726 CAGTGCTAGCACCGAGGAGGAGG + Intronic
912529195 1:110307887-110307909 AAGGGCCAGGAGTGGGGAGGGGG - Intergenic
913045045 1:115067156-115067178 CAGGGACTGCACTTTGGAGTAGG - Intronic
914197290 1:145454172-145454194 CAGGGCCAGCACGATGCAGTTGG + Intergenic
914988793 1:152480817-152480839 CAGAGCAAGCAGAGTGGAGGTGG - Intergenic
915038532 1:152948648-152948670 GGGGGGCAGCACTGTTGAGGCGG - Intergenic
915691509 1:157695548-157695570 CAGGGCCCACACTGTGGTGGGGG - Exonic
916777358 1:167981158-167981180 TAAGCCCAGCACTTTGGAGGCGG - Intronic
916967418 1:169964373-169964395 TCGGGCCAGCAATGTGGAAGAGG + Intronic
917958707 1:180125786-180125808 CAGGGTCAGCATTGTCCAGGAGG - Intergenic
918097961 1:181349990-181350012 CAGGGACAGCAAAGTTGAGGAGG - Intergenic
920093720 1:203472163-203472185 CAGGACCACCACGGGGGAGGTGG + Intergenic
920563420 1:206955670-206955692 CAGGGCCAAGAGTTTGGAGGGGG - Intergenic
921361536 1:214334535-214334557 CACGGCCAGCCCTCTGGATGTGG - Intronic
922423485 1:225474444-225474466 CATGGCCAGTGCTGTGGAGTGGG - Intergenic
922941152 1:229467677-229467699 CAATCCCAGCACTTTGGAGGTGG + Intronic
923216418 1:231852034-231852056 CAGGAACAGCACTGTGAGGGAGG + Intronic
923465769 1:234246946-234246968 CAGGCACAGCACAGAGGAGGTGG + Intronic
923928400 1:238662839-238662861 AAGGGCCAGAACTGTGAGGGTGG - Intergenic
1062870107 10:893862-893884 CAAGGCGAGCACTGTGGTGGTGG - Intronic
1063879970 10:10521077-10521099 CAGGGTCAGCACTGAGCAAGAGG + Intergenic
1064202948 10:13299899-13299921 CAGGGCCACCACTCAGGCGGCGG + Intronic
1065990645 10:31006464-31006486 CAGGGCCAGGCATGTGGAAGGGG - Intronic
1066050851 10:31633424-31633446 CAGTGCCAGGGCTGTGGTGGGGG - Intergenic
1067088763 10:43256073-43256095 TAGGGGGAGCACTGTGCAGGAGG + Intronic
1067407155 10:46033603-46033625 CAGAGCTGGCACTGGGGAGGGGG - Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067799722 10:49350688-49350710 CAGGGACAGCATGGAGGAGGTGG + Intergenic
1068029134 10:51685928-51685950 CAGGGCCAGCACTGTGGCAAAGG - Intronic
1068905388 10:62316444-62316466 CAGGGCCAGCTTTGTGGGTGTGG + Intergenic
1068987479 10:63120673-63120695 CAGGGCCAGCAGATGGGAGGAGG + Intergenic
1069069096 10:63975761-63975783 CAGGGCTAGCATTCTGGTGGGGG - Intergenic
1069823313 10:71240487-71240509 CAGGGCCAGCAGGGTGGACACGG + Intronic
1069873281 10:71546171-71546193 CATGACCAGCACTGGAGAGGCGG - Intronic
1070458399 10:76641034-76641056 CAATGCCAGCAATATGGAGGAGG + Intergenic
1070516162 10:77209077-77209099 AAGAGACAGCTCTGTGGAGGCGG - Intronic
1070775357 10:79106634-79106656 CAGGGCCTGCAATGTGGTTGGGG - Intronic
1071563320 10:86659187-86659209 CAGGGCCAGGGCTGTGTATGGGG + Intronic
1072207461 10:93216853-93216875 CAGAGCAGGTACTGTGGAGGAGG - Intergenic
1073257245 10:102160774-102160796 CAGCTCCAGCAGTGAGGAGGAGG + Exonic
1074406410 10:113183679-113183701 CAGGCCCAGCACTGTGCACAAGG - Intergenic
1075065747 10:119287942-119287964 CAGGGCCAGCAGGGAGGACGGGG - Intronic
1075090805 10:119443398-119443420 CAGGGCAAGCTCCCTGGAGGGGG + Intronic
1075616051 10:123891621-123891643 CAGGGCCAGCGCTGGGGTAGCGG + Exonic
1075936122 10:126342943-126342965 CAGGACCAGCAGAGAGGAGGAGG - Intronic
1076195689 10:128516239-128516261 CAGGGCCAAAACTGTGCAAGCGG + Intergenic
1076216772 10:128701381-128701403 CAGGGACAGCCACGTGGAGGTGG + Intergenic
1076358531 10:129870170-129870192 GATGGCTATCACTGTGGAGGAGG - Intronic
1076673554 10:132136239-132136261 CAAGCCCAGCCCTGGGGAGGGGG + Intronic
1076695574 10:132245839-132245861 CAGGGGCAGAACCGTGGAGTCGG - Intronic
1076787927 10:132760264-132760286 CAGGGCCAGCACCGAGGACTGGG + Intronic
1076819120 10:132930011-132930033 CGGGGCCAGCACAGTTGTGGAGG + Intronic
1077150560 11:1071254-1071276 CAGGGCCAGAGCTGTGGCGCTGG + Intergenic
1077187221 11:1240750-1240772 CAGGGCCAGCCCTGGGGAAAGGG + Intronic
1077353391 11:2103436-2103458 CAGGGACAGCTCTGTGGGAGAGG - Intergenic
1077368725 11:2171810-2171832 CTGGGCCAGGGCTGTGGAGACGG - Intronic
1077783813 11:5360978-5361000 CAGGGCCTGCAGTGGGGTGGGGG + Intronic
1078095135 11:8292026-8292048 CAGGGCAAGCAATATGGATGTGG + Intergenic
1083170617 11:60922138-60922160 GGGGGCCCGCAGTGTGGAGGAGG + Exonic
1083594366 11:63911927-63911949 CAGGGCGGGCGCTGTGGCGGGGG + Exonic
1083742833 11:64720278-64720300 CAGGCCCATCAGTGTGGAAGGGG + Intronic
1083803170 11:65058275-65058297 CAGGGCCAGCATCAGGGAGGGGG + Intronic
1084370673 11:68740548-68740570 GAAGGCCAGCAGCGTGGAGGGGG + Intronic
1084383411 11:68827874-68827896 CAGGGCCAGGGCTGTGTAGGTGG - Intronic
1084950204 11:72660885-72660907 CAAGGCCAGCTCTGGGAAGGAGG + Intronic
1085299115 11:75448232-75448254 CAGGGCCATCTCTCTGGAGCAGG - Intronic
1087607883 11:100399090-100399112 CATGCCAAGCACTGTGGAAGAGG - Intergenic
1088037389 11:105334191-105334213 CAGTGGCAGCACGCTGGAGGTGG + Intergenic
1088723403 11:112613759-112613781 TGGAGCCAGCACTGTGGGGGTGG - Intergenic
1089318882 11:117611588-117611610 CAGGGCAAGAAGTTTGGAGGAGG - Intronic
1089384370 11:118058365-118058387 CAGGGCCAGGAGTGTGGGGAAGG + Intergenic
1089401382 11:118166526-118166548 CAGGCCAAGCACTGGGCAGGTGG + Exonic
1091866220 12:3839289-3839311 CAGGACCAGCAACATGGAGGCGG + Intronic
1091951615 12:4597633-4597655 GAGGGCCAGGGCTGTGCAGGGGG + Intronic
1092100097 12:5876069-5876091 CAGGGCCAGCCCAGCTGAGGAGG + Intronic
1092211100 12:6647002-6647024 CAGGAGCAGCACTGCGGAGCGGG + Exonic
1095599981 12:44002865-44002887 CAGGGACAGGACTTTGTAGGTGG + Intronic
1096522525 12:52192199-52192221 CAGGCCTAGCTCTGGGGAGGGGG + Intergenic
1096558253 12:52417523-52417545 TAGGGCCAGCAGTGTCAAGGTGG - Intergenic
1096574523 12:52544428-52544450 CAGGACCAGCAGGGTGGAGATGG + Exonic
1097030762 12:56087706-56087728 CTGGGTCAACACTGTGGGGGAGG + Intronic
1097145902 12:56939214-56939236 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1097151463 12:56982752-56982774 CAGGGCCAGGCCTGTGGAGGAGG - Intergenic
1100341427 12:93683258-93683280 CAGGGCCAACACAGTGGAACAGG - Intronic
1101937340 12:109069181-109069203 AAGGGACAGCACTGCAGAGGAGG - Intronic
1102037160 12:109777718-109777740 CAGGGCCAGCCCTCAGGAAGAGG - Intergenic
1102118458 12:110421751-110421773 CAGGGGCAGATCTGTGCAGGGGG - Intergenic
1105591307 13:21795206-21795228 CATGGCCAGCCCTGTGGCGTTGG - Intergenic
1105937736 13:25117601-25117623 CGGGGGCAGCACTGGGGCGGGGG - Intergenic
1105966435 13:25388808-25388830 CACGGCCAGCAATGGGCAGGAGG + Intronic
1107448190 13:40486491-40486513 CTGGGCCTGCTCTGTGAAGGTGG + Intergenic
1107463883 13:40631156-40631178 GAGTGGCAGCATTGTGGAGGAGG + Intronic
1109669140 13:65582369-65582391 CTGGGGCAGCCCTCTGGAGGTGG - Intergenic
1111148081 13:84211069-84211091 CAGGGTCAGCAATGTGGGAGTGG + Intergenic
1111979694 13:95003110-95003132 CAGGCCCAGCTCTGTGGCAGAGG + Intergenic
1112037679 13:95512678-95512700 CATGGCCAGCGTGGTGGAGGTGG - Intronic
1113923785 13:113929271-113929293 CTGGGCCAGCCCTGAGGAGGTGG - Intergenic
1114309737 14:21455991-21456013 CTGGCCCAGCACTGAGGAGCGGG + Intronic
1114567927 14:23646075-23646097 GAGGCTCAGCACAGTGGAGGGGG + Intergenic
1115258400 14:31427184-31427206 CAGAGCTAGGACTGAGGAGGAGG + Intronic
1115522948 14:34251592-34251614 CATGGTCAGCACTGAGGAGGTGG + Intronic
1117072214 14:52067987-52068009 CAGGCCCAGCACTGCGGGGGAGG + Exonic
1118589792 14:67392790-67392812 CACGGCCAGCCGTCTGGAGGCGG - Exonic
1119319487 14:73721247-73721269 CAGGGCAAGCAGGGTGGAGCTGG - Intronic
1119484861 14:74980720-74980742 CAGGGCCAGGACTGTGGGGATGG - Intergenic
1119708866 14:76806751-76806773 CAGGGCTAGCACAGAGCAGGCGG + Exonic
1119775073 14:77243165-77243187 CAGTGCGAACATTGTGGAGGTGG + Intronic
1120938197 14:89919343-89919365 CAGGGCCTGCACTGTTAAGTGGG - Intronic
1121273295 14:92651894-92651916 CAGGGGCAGCACTGGGGGAGGGG - Exonic
1121861724 14:97324887-97324909 CTGGCACAGCACTGTGGGGGAGG + Intergenic
1122325522 14:100879052-100879074 CATGTCCTGGACTGTGGAGGGGG + Intergenic
1122348424 14:101074288-101074310 CAGAGCCAGCAGTGTGTGGGGGG - Intergenic
1122535794 14:102461650-102461672 CAGGGCCAGCTTCGTGGAGCGGG - Intronic
1122634085 14:103122246-103122268 CTTGGCCAGCACTCTGGAAGAGG + Intergenic
1122816171 14:104315281-104315303 CAGGGGCAGGACTGTGGGGTCGG - Intergenic
1122969015 14:105144935-105144957 GGGGGCCAGTGCTGTGGAGGTGG - Exonic
1123003850 14:105312026-105312048 CAGGGCCAGCACTGGTCAGTTGG - Exonic
1123068387 14:105629343-105629365 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123072398 14:105648148-105648170 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123092407 14:105747667-105747689 CGGAGCCAGCACGGGGGAGGTGG - Intergenic
1123097984 14:105775368-105775390 CGGAGCCAGCACAGGGGAGGTGG - Intergenic
1123113039 14:105881918-105881940 CAGGCCCAGCACTGCAGTGGAGG + Intergenic
1202903944 14_GL000194v1_random:57993-58015 CTGGGCCAGCACTGCGGGTGTGG - Intergenic
1124417490 15:29485281-29485303 CAGGTCCTGCACTGTGGAGCTGG - Intronic
1124441251 15:29687906-29687928 CAGGGCCAGCCCTGGGAATGGGG + Intergenic
1124555285 15:30719503-30719525 CTGGCCCAGCGCCGTGGAGGAGG - Intronic
1124819590 15:33031308-33031330 AGGAGCCAGCACTGTGGAGAGGG + Intronic
1125548383 15:40525680-40525702 CAGGGTCAGCTCTGAGGAGCAGG - Intergenic
1126849039 15:52786643-52786665 AGGGGACGGCACTGTGGAGGGGG - Intronic
1127157632 15:56145967-56145989 AAGGGCAAGAACTGTGGTGGTGG - Intronic
1127794774 15:62428077-62428099 CAAGACCAGAATTGTGGAGGGGG - Intronic
1127931042 15:63597759-63597781 CGGGGCCAGCACTGCTCAGGAGG - Intronic
1128340743 15:66821098-66821120 CAGGGCCTTCTCTCTGGAGGGGG - Intergenic
1128358242 15:66943330-66943352 CAGGGCCAGCTCTGGGGGGCAGG + Intergenic
1128676652 15:69614860-69614882 GAGGGCCAGCACAGTGGGGCTGG - Intergenic
1129239960 15:74245290-74245312 CAGGGCCCCCACTGTGAAAGGGG + Intronic
1129250947 15:74308742-74308764 CAGGGTCCACCCTGTGGAGGTGG - Intronic
1129296108 15:74600991-74601013 CAGGGGCTGCAAGGTGGAGGTGG + Intronic
1129317223 15:74752272-74752294 CATGGCAAGCACTTTAGAGGTGG - Intronic
1130076670 15:80695548-80695570 CGGCGCCAGCACCGTGTAGGTGG - Exonic
1130150340 15:81306799-81306821 CAGGGCCAGGACTCTAGAGTGGG + Intronic
1130997566 15:88912472-88912494 CAGGGCCAGGACTCTTTAGGTGG - Intronic
1131131696 15:89904563-89904585 CAGGGCCAGGAGAGAGGAGGGGG - Intronic
1132113838 15:99121258-99121280 CAGGGCCAGCACTGTGGAGGGGG + Intronic
1132808450 16:1786609-1786631 CAGGGCCAGCTCCGTGGAGATGG - Exonic
1132853257 16:2034147-2034169 CCGGGCCAGCACTGTGGGGCTGG + Intronic
1132931792 16:2462432-2462454 CAGGCTCAGTGCTGTGGAGGTGG + Exonic
1133803795 16:9107426-9107448 CAGGGCAGGCCCTCTGGAGGAGG + Intronic
1134067246 16:11236758-11236780 CAGGGCCAGCAATTTGGCAGAGG + Intergenic
1134189188 16:12108244-12108266 AAGGGCCAGGACTGAGGTGGGGG + Intronic
1135035793 16:19075755-19075777 CATGGCCTGCACCGTGGCGGTGG + Exonic
1135048037 16:19169820-19169842 CAGTGCCAGCACTTAGTAGGCGG - Intronic
1136358320 16:29761149-29761171 GAGGGCCTGGACTGGGGAGGAGG + Intergenic
1136365312 16:29806736-29806758 CAGGCCCAGCACGGGGAAGGGGG - Exonic
1137002802 16:35246010-35246032 CAGGGCCAGGAGTGTGGCTGAGG + Intergenic
1137024413 16:35457990-35458012 CATGGCCAGCCCTGTGTATGGGG + Intergenic
1137252037 16:46747806-46747828 CAGGGCCATCGCTTTGGTGGGGG - Exonic
1137552122 16:49444798-49444820 CAGGGCCTGAAATGGGGAGGTGG + Intergenic
1138520362 16:57567597-57567619 CAGGCCCAGCACTGTGGCAGCGG - Intronic
1139748051 16:69090254-69090276 GAGGGCCAGCACGGGGGAGGTGG - Intergenic
1139847224 16:69929578-69929600 CAGCTCCAGCACTGGGCAGGTGG + Intronic
1140875960 16:79152808-79152830 GTGGGCCAGCACTGGGGTGGAGG + Intronic
1141836046 16:86540323-86540345 GAGGGTCAGCACTGTGGGGGAGG - Intronic
1141945996 16:87310632-87310654 CAGAACTAGCGCTGTGGAGGCGG + Intronic
1141994739 16:87629053-87629075 CAGGGCTAACGCTGTGGGGGGGG + Intronic
1142314689 16:89336236-89336258 CAGGTCCAGCTCTGTTGATGTGG - Intronic
1142500699 17:331400-331422 CAGGGCCACCCCTGTGAACGTGG - Intronic
1142860228 17:2756350-2756372 GCGGGCCAGGACTGCGGAGGGGG - Intergenic
1143610247 17:8013903-8013925 AAGGGCCGACACAGTGGAGGGGG - Exonic
1143686748 17:8523561-8523583 GAAGGCCAGCACGGAGGAGGAGG + Intronic
1143985831 17:10913141-10913163 CAGGGACGGAAGTGTGGAGGTGG + Intergenic
1144568872 17:16382393-16382415 CAAGACCATCACTCTGGAGGTGG + Exonic
1144617393 17:16789014-16789036 CAGGGTCAGAAATGTGGAGAGGG - Intronic
1144767724 17:17741794-17741816 CAGGCCCAGCACCCTGGATGTGG - Intronic
1144881515 17:18433078-18433100 CAGGTCCAGCAGTGAGGACGTGG - Intergenic
1145136912 17:20417563-20417585 CAGGGTCAGAAATGTGGAGAGGG - Intergenic
1145150718 17:20511308-20511330 CAGGTCCAGCAGTGAGGACGTGG + Intergenic
1145276049 17:21431438-21431460 CAGGGCCACCGCTGAGGAGGAGG - Intergenic
1145313895 17:21717352-21717374 CAGGGCCACCGCTGAGGAGGAGG - Intergenic
1145712337 17:26989326-26989348 CAGGGCCACCGCTAAGGAGGAGG - Intergenic
1145901166 17:28491379-28491401 CAGGGCCAGCTCTGGGGAACGGG - Intronic
1145961073 17:28886849-28886871 CAGGGCTGGCACTGTGGGGGTGG - Intronic
1145973156 17:28968708-28968730 AAGAGCCAGCACTCTGGAGATGG - Intronic
1146676712 17:34778784-34778806 AAGGTCCAGCAGTGGGGAGGTGG + Intergenic
1147240112 17:39085341-39085363 CAGGGGCTGCCCTGTGCAGGAGG + Intronic
1147256682 17:39185890-39185912 CAGGGCCAGCACTTTGGTGGAGG - Intronic
1147579059 17:41618338-41618360 CAGGTCCAGCAGTGATGAGGTGG + Intergenic
1148159961 17:45444152-45444174 CTGGGCCAGCCCTGTGGGGAGGG + Intronic
1148622076 17:49042272-49042294 GAGGACCATCACTGTGAAGGGGG + Exonic
1148871404 17:50660643-50660665 TGGAGCCAGCACTGGGGAGGCGG + Intronic
1149119887 17:53150245-53150267 CAGGGCCACCTGTGTGGAGAGGG - Intergenic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1149649734 17:58269294-58269316 CAGGGCCAGCACTGAGGGAGGGG - Intergenic
1149656897 17:58314729-58314751 AAGCACCAGCACTGTGGAGTGGG + Intronic
1150391251 17:64791031-64791053 CTGGGCCAGCCCTGTGGGGAGGG + Intergenic
1151235225 17:72715080-72715102 CAGGGTCTGCACTCAGGAGGAGG + Intronic
1151288827 17:73133668-73133690 CAGGCCCAGCTCTGTACAGGGGG + Intergenic
1151481544 17:74372584-74372606 CAGGGGCAGAAGTGTAGAGGAGG + Exonic
1151915919 17:77117925-77117947 CAGTGCCAGCCTTGTGTAGGGGG - Intronic
1151956089 17:77380926-77380948 GAGGGGCAGCACTGTAGAAGGGG - Intronic
1151956492 17:77382790-77382812 CAGGCCCAGTACTGTGCAGAGGG + Intronic
1151987600 17:77554096-77554118 AAGGGGCAGAACCGTGGAGGGGG - Intergenic
1152028080 17:77824635-77824657 CAGGGCCAGGAATGAGGAGAAGG + Intergenic
1152139414 17:78527628-78527650 CAGGGGCAGGATTGTGGTGGAGG - Intronic
1152450746 17:80377984-80378006 CAGACTCAGCACTGTGGACGTGG + Intronic
1152465205 17:80462343-80462365 CAGGGCCAGCAGGGAGGAGGGGG + Intergenic
1152725328 17:81942193-81942215 CAGGGCCAGCTGTGCGGGGGAGG + Intronic
1152754548 17:82081833-82081855 CACGGCCAGGCCTGTGGGGGAGG + Exonic
1153487029 18:5609455-5609477 CAGGGCCAGGCCTGGGAAGGAGG - Intronic
1153962587 18:10152247-10152269 CAGAGCCAGCAGTGGGCAGGTGG - Intergenic
1157220506 18:45825665-45825687 GAGGGCCCTCACTGGGGAGGTGG + Exonic
1157335248 18:46733062-46733084 CAGGGCCAGCACAGCCCAGGGGG + Intronic
1157701604 18:49764365-49764387 CAGGGCCTGGAGTGGGGAGGGGG + Intergenic
1158158925 18:54457753-54457775 CAGGGCAATGACTGGGGAGGTGG + Intergenic
1159619601 18:70621963-70621985 CAGTGCTGGCACCGTGGAGGAGG + Intergenic
1161118727 19:2513346-2513368 CTAGGCCAGCCCCGTGGAGGGGG + Exonic
1161505202 19:4639966-4639988 CTGGGCCAGCCGTGCGGAGGTGG + Intronic
1161719870 19:5896784-5896806 GATGGCCAGCACTGTGGACACGG + Intronic
1162155047 19:8671839-8671861 CAGGGCCAGGAATGTGGCAGGGG + Intergenic
1162453982 19:10771494-10771516 CAAGACCAGCTCTGAGGAGGCGG + Intronic
1162824816 19:13244942-13244964 TAGGGCCAGCACTGAGGGGTGGG - Intronic
1163153477 19:15428067-15428089 CAGGGCCCGCAGTGAGGAGGGGG + Intronic
1163365551 19:16874030-16874052 CAGGGCCTGGGCTGTGCAGGCGG + Intronic
1165051178 19:33142508-33142530 CAGTGCCTGCATTGTGGATGGGG + Intronic
1165380578 19:35476649-35476671 CAATGGCGGCACTGTGGAGGCGG - Intergenic
1165831985 19:38735009-38735031 CAGGGCCAGGGCTGTGACGGGGG + Intronic
1166228932 19:41414300-41414322 CAGGGTTAGGACTCTGGAGGGGG + Intronic
1166774372 19:45303360-45303382 TAGGGTCAGCATTGGGGAGGGGG - Exonic
1166790944 19:45398137-45398159 CATGGCCAGCGCTGGGAAGGTGG + Exonic
1166980865 19:46631293-46631315 CAGGACCAGGAATGTGAAGGAGG + Intergenic
1167287343 19:48605927-48605949 CAGGGCCAGCTACGTGCAGGGGG - Intronic
1167502629 19:49856360-49856382 AGGGGACAGCACTGTGGGGGTGG + Intronic
1167982833 19:53290241-53290263 CAGTGCTTTCACTGTGGAGGAGG - Exonic
925673556 2:6336927-6336949 TAGTGCCAGCAGTGTGGAGTGGG + Intergenic
927138216 2:20112786-20112808 CAGAGCCAGAACTGTGGGGCTGG + Intergenic
927212382 2:20646752-20646774 CACTGCCACCAGTGTGGAGGAGG + Intronic
927810793 2:26179249-26179271 CAAGGCCAACACTGGGGAAGTGG - Intronic
929934229 2:46282626-46282648 GAGGGGCTGCACTGAGGAGGGGG + Intergenic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
934090067 2:88543416-88543438 CACAGCAATCACTGTGGAGGTGG + Intergenic
934938319 2:98481099-98481121 CAATGCCAACACTGGGGAGGGGG + Intronic
935113605 2:100114218-100114240 CTGGGCCAGCTCTGTGCAGAGGG - Intronic
937036280 2:118785313-118785335 CAGAGCAAGCAATTTGGAGGTGG - Intergenic
937250319 2:120519624-120519646 CGGGGAGAGCCCTGTGGAGGGGG - Intergenic
937452049 2:122010068-122010090 CAGGGGCAGCAATGTAGAGACGG - Intergenic
938159509 2:128972923-128972945 CAGGGACAGCAAAGTGGAAGAGG - Intergenic
938263462 2:129910870-129910892 CAGGACCTGCCCTGTGGAGTTGG - Intergenic
938277346 2:130038042-130038064 CAGGCCCAGGGCTGTGGCGGCGG - Intergenic
938328319 2:130428845-130428867 CAGGCCCAGGGCTGTGGCGGTGG - Intergenic
938361628 2:130692649-130692671 CAGGCCCAGGGCTGTGGCGGTGG + Intergenic
938438038 2:131299338-131299360 CAGGCCCAGGGCTGTGGCGGCGG + Intronic
938711007 2:133976245-133976267 CAGGACCGGCACTGTGCAGGTGG + Intergenic
939896676 2:147800272-147800294 GAGGGCCAGCAGTCAGGAGGAGG + Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
944243668 2:197510207-197510229 TAGTCCCAGCACTTTGGAGGCGG - Intronic
944302068 2:198134813-198134835 GAAATCCAGCACTGTGGAGGTGG + Intronic
944543260 2:200774555-200774577 CAGCACCAGCACTGTGGTGACGG - Intergenic
945906254 2:215596764-215596786 CAGGAGCATCACTGTGGAGAAGG - Intergenic
946153798 2:217793891-217793913 CAGGGCCAGACCTGGGAAGGGGG + Intergenic
946302180 2:218830716-218830738 CAAGGCCAGTTCTGGGGAGGTGG - Intronic
947525335 2:230873874-230873896 CAGGGTCTGAGCTGTGGAGGGGG - Intronic
948361879 2:237427672-237427694 CATGGCCATCCCTGTGGAAGGGG + Intergenic
948976225 2:241465344-241465366 CAGGTCCTGCCCTGGGGAGGGGG - Intronic
949058880 2:241945112-241945134 CATGGCCTCCAATGTGGAGGTGG + Intergenic
1170150081 20:13220138-13220160 CTGGGCCGGCGCTGGGGAGGAGG + Intergenic
1170547714 20:17449268-17449290 AAGAGCCAGCACTGTGGGTGGGG - Intronic
1172385284 20:34529893-34529915 CAGGGGCAGCCCTGAGCAGGGGG - Intronic
1172528967 20:35617612-35617634 CAGGAACAGCTCTTTGGAGGGGG + Intronic
1172637773 20:36421560-36421582 CTGGGGCAGGGCTGTGGAGGTGG + Intronic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173553672 20:43950483-43950505 CAGAGCAAGCAGTGGGGAGGGGG - Intronic
1174046221 20:47735829-47735851 CAGGTCCAGCACTGCGGACAGGG + Intronic
1175199163 20:57266296-57266318 CGGGGCCAGCACCGAGCAGGGGG - Exonic
1175997882 20:62819484-62819506 CAGAGCCAGCCCAGTGGAGTCGG + Intronic
1176623314 21:9072761-9072783 CTGGGCCAGCACTGTGGGTGTGG - Intergenic
1178472626 21:32907010-32907032 CAGGGCATTCACTGTGGAGGAGG - Intergenic
1178842153 21:36146395-36146417 CAGCATCAGGACTGTGGAGGAGG + Exonic
1178893936 21:36543274-36543296 ATGTGCCAGCACTGTGAAGGGGG + Intronic
1179157091 21:38859986-38860008 CAGGGCGGGCTCTCTGGAGGAGG + Intergenic
1179437752 21:41373947-41373969 CAGGGACTGCGCTGTGCAGGAGG - Intronic
1179505384 21:41836412-41836434 CAGGGCCAGGACTGGGGCTGGGG - Intronic
1179727293 21:43347631-43347653 GGGGGCCGGCACTGTGGACGGGG - Intergenic
1179911199 21:44449869-44449891 CAGGGGCAGCACCGTGGTGAGGG - Intergenic
1179961782 21:44771638-44771660 CGTGGCCAGCACTCTAGAGGTGG - Intronic
1180712035 22:17845986-17846008 CAGGGCCAGAGCTCTGGAAGGGG + Intronic
1181167943 22:20993298-20993320 CAGGGCCAGCTTCCTGGAGGAGG + Intronic
1181335421 22:22124891-22124913 CATTGCCAGCAGTGTGGGGGGGG + Intergenic
1181618304 22:24070419-24070441 CAGTGCCAGGGCTCTGGAGGGGG - Intronic
1181669761 22:24420595-24420617 CAAGGCCAAGACTGAGGAGGTGG + Intronic
1181965457 22:26653411-26653433 CAAGGCAAGCAGTGGGGAGGTGG - Intergenic
1182155331 22:28066742-28066764 CAGGGCCAGAAGTGTGGAATAGG - Intronic
1182442050 22:30370423-30370445 CAAGCCTAGCACTGGGGAGGAGG - Exonic
1182568345 22:31216509-31216531 CAGGGCCACCAATCTGGAGGTGG + Intronic
1183078879 22:35443707-35443729 CTGGGCCCCCACTGTGCAGGAGG - Intergenic
1183529852 22:38347450-38347472 CAGGGCCAGGGGTGAGGAGGAGG + Intronic
1183746400 22:39694349-39694371 CAGGGCCAGCCCTGGAGATGAGG - Intergenic
1184149670 22:42630850-42630872 CTGGGTCATGACTGTGGAGGGGG - Intronic
1184489117 22:44799144-44799166 CAGGCCCAGCACAGGGGCGGGGG - Intronic
1184528673 22:45040643-45040665 CAGGCCCAGCACTGAGGACCCGG + Intergenic
1184677718 22:46052839-46052861 AAGAGCCAGCCCTTTGGAGGAGG + Intronic
1185185705 22:49398380-49398402 CGGGGCCAGCACTGTGATGCCGG + Intergenic
1185318498 22:50189557-50189579 CAGTGCCAGCACTGGGGATTTGG + Intronic
949376140 3:3392510-3392532 CAGTGCCAGCACTGGGGATGGGG - Intergenic
949533897 3:4980546-4980568 AAACGCCAGGACTGTGGAGGAGG - Intronic
950242492 3:11384186-11384208 CAGGAGCAGGACTGTGCAGGAGG + Intronic
950503266 3:13377599-13377621 CAGGGGCAGCAGGGTGGAGGAGG + Intronic
950627709 3:14260369-14260391 CAGAGCCTGCTCTGAGGAGGCGG + Intergenic
950660346 3:14463419-14463441 CAGGGACAGGGGTGTGGAGGTGG - Intronic
950930510 3:16784276-16784298 CAGGGCCAGTACTGAGAGGGTGG + Intergenic
951981872 3:28575565-28575587 CAGGGCCAGCGCGGAGGCGGGGG + Intergenic
952344200 3:32468832-32468854 CAGGGCTAGCACTGCAGTGGTGG - Intronic
953920429 3:46947764-46947786 CAGGCACAGCACTGTGGTAGAGG + Intronic
954753994 3:52829171-52829193 TAGGGCCAATACTGTGCAGGAGG - Exonic
954754768 3:52833188-52833210 AAGGGCCTGGACTGTGGGGGAGG + Exonic
954799958 3:53181314-53181336 CAGAGCCAGCACTGAGGTGTAGG + Intronic
955034694 3:55255879-55255901 CAGGGACAGCCCTGTGGAGAAGG - Intergenic
955341650 3:58129861-58129883 CATGGACTCCACTGTGGAGGGGG - Intronic
955598171 3:60614354-60614376 CAATCCCAGCACTTTGGAGGTGG + Intronic
956250643 3:67230715-67230737 CAGGGACACCACCGTGGAGTGGG - Intergenic
956555439 3:70516942-70516964 CAGGGCCAGCACTCCAGAGATGG + Intergenic
958904729 3:99929220-99929242 CAGGGCCACCACTAGGGAGAAGG - Intronic
960544016 3:118891337-118891359 CAGGATCAGCACTGTGAAGTTGG + Intergenic
961043251 3:123692322-123692344 CAGGGTCAGCCGTGAGGAGGAGG - Intronic
961537041 3:127576635-127576657 CAGGGACAGCACTGTGGTGATGG + Exonic
961593580 3:127998862-127998884 AAGGGCCTGCAATGAGGAGGTGG - Intergenic
961640675 3:128363052-128363074 GAGAGCCAGCACTCAGGAGGAGG + Intronic
961781923 3:129325460-129325482 CAGGGGCAGCAGGGTGGAGGAGG + Intergenic
961781978 3:129325640-129325662 CAGGTCCCTCTCTGTGGAGGAGG - Intergenic
964129960 3:153275956-153275978 GAGGGCCAGTAAAGTGGAGGTGG + Intergenic
965619971 3:170633580-170633602 CAGGTCCAGCACCGAGGAGGTGG + Intronic
967290330 3:187913637-187913659 CAAGACCTGCACTGTGGCGGGGG - Intergenic
968089916 3:195893344-195893366 CAGGGCCACCCCAGGGGAGGGGG - Intronic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
969206991 4:5654584-5654606 CAGGGGCATCACTGTGGGGGTGG + Intronic
969367570 4:6707198-6707220 CAGTTCCAGCACTGGGGAGATGG - Intergenic
969465352 4:7353186-7353208 CAGGGCCATCCCTGCAGAGGTGG + Intronic
969618082 4:8265338-8265360 CAGCACTCGCACTGTGGAGGAGG + Intergenic
969994821 4:11301356-11301378 CAGGTCCAGGACTGGGGAAGAGG - Intergenic
970299659 4:14667994-14668016 CAGGGCTAATACTGTGGTGGTGG - Intergenic
975811599 4:78175669-78175691 CAGAGCCAGCTCTGTGGAGAGGG + Intronic
976359299 4:84158728-84158750 CTTGCCCAGCACTGTGGTGGTGG - Intergenic
976890470 4:90040169-90040191 CAAGGCAGGCAGTGTGGAGGAGG - Intergenic
979515796 4:121608588-121608610 TGGTTCCAGCACTGTGGAGGTGG - Intergenic
984067187 4:175062699-175062721 CAGGGACAACCCTGTGGAAGAGG - Intergenic
984701144 4:182819538-182819560 CTGGACCAGCACTGCGGAGATGG - Intergenic
985732388 5:1556537-1556559 CAGGGCCAGCAGTGGGGTGCGGG + Intergenic
985817171 5:2135618-2135640 CAGGCCCAGCACTGTGCTGAGGG + Intergenic
989779483 5:45247110-45247132 CACGGGCAGCAGTGTGGAGGTGG + Intergenic
995159073 5:108954168-108954190 CAGGGCCAGCCATGTGGCAGAGG + Intronic
995476635 5:112554765-112554787 CAGAGACACCACTGTGGTGGTGG + Intergenic
995794560 5:115927920-115927942 CAGGGCCAGCTCATTGGAGTGGG - Intergenic
995872636 5:116758904-116758926 GAGCGCCAGCATTGTGTAGGTGG + Intergenic
997231831 5:132251158-132251180 CAGGATCAGCAGTGTGGAGTTGG - Intronic
998523542 5:142821741-142821763 CAGTGCCAACTCTGTGTAGGAGG + Intronic
998623621 5:143821501-143821523 AATGGCCAGAACTGGGGAGGCGG + Intergenic
998758091 5:145402970-145402992 CAAGGCAAGCACTGAGGAGTTGG - Intergenic
999079838 5:148832808-148832830 CAAGGCCTGCACTGAGCAGGAGG + Intergenic
999326934 5:150649589-150649611 CAGGGCCAGCCCCGCGGCGGCGG + Exonic
999762374 5:154712636-154712658 CAGGACCAGGGCTGTGGAGGAGG + Intergenic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1006020778 6:31116467-31116489 GGGGTCCAGCTCTGTGGAGGCGG - Exonic
1006069820 6:31490353-31490375 CAGAGCCAGCACTGAGGGAGAGG + Intergenic
1006401334 6:33819412-33819434 CAGGTCCAGCACGGGGGTGGGGG - Intergenic
1007838666 6:44697655-44697677 CAGGGCCTGCCCCTTGGAGGTGG + Intergenic
1007908988 6:45494238-45494260 GAGGGCCAGGCCTGTGGAGGTGG - Intronic
1008348162 6:50455108-50455130 CTGGGCCAGCAGGGTGGCGGTGG - Intergenic
1013308452 6:108871693-108871715 CTGGGGAAGCACTGAGGAGGGGG - Intronic
1013327981 6:109067312-109067334 CAGGGTGGGCACTGTGCAGGAGG - Intronic
1013488342 6:110619438-110619460 CTGGGGCAGCACAGTAGAGGAGG + Intronic
1014333085 6:120095748-120095770 CAAGGTCAGCAGGGTGGAGGAGG + Intergenic
1015790208 6:136957985-136958007 CAGGGCCTGCACTGGGGCAGGGG - Intergenic
1016489615 6:144583057-144583079 CAGGGCATGCACCGTGGTGGTGG + Intronic
1017724542 6:157267874-157267896 CAAAGCCAGCACCGTGGAGCTGG + Intergenic
1018690222 6:166338657-166338679 CAAGGCAAGCACTGGGGAGAGGG + Intronic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1019233016 6:170584548-170584570 CGGGGCCAGGCCTGTGGAGCTGG - Exonic
1019496672 7:1343799-1343821 CAGGGCTTGCAGGGTGGAGGAGG + Intergenic
1019726522 7:2605917-2605939 CACGGGCAGCCCTGTGCAGGAGG + Exonic
1020244860 7:6422252-6422274 CAGGGGCAGCTCCCTGGAGGAGG + Intronic
1022089846 7:27100934-27100956 ATGGGCCAGAACTGTGGAGCTGG - Exonic
1022423927 7:30249536-30249558 CATGGCCAGAACTGTGAATGAGG + Intergenic
1024044622 7:45578287-45578309 CTGGGCCGGCACTGAGGGGGAGG + Intronic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024272892 7:47655800-47655822 ACGGGCCAGCAGTGTGGACGGGG - Intronic
1024990769 7:55233277-55233299 CAGGGCCTGCATTCTGAAGGCGG - Intronic
1026969062 7:74456933-74456955 CATGGCCAGCCCTGAGGACGAGG - Intronic
1027138088 7:75638871-75638893 CCGGGCCAGGATTCTGGAGGCGG - Intronic
1028467451 7:91168920-91168942 ACGGCCCAGCACAGTGGAGGGGG - Intronic
1028775651 7:94673251-94673273 CAGATCCAGAACTGGGGAGGAGG - Intergenic
1028953990 7:96668005-96668027 CAGTGACAGACCTGTGGAGGTGG + Intronic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029168125 7:98610395-98610417 CAGGGTAAGCTTTGTGGAGGGGG + Intergenic
1029472793 7:100765157-100765179 CAGGGCCAGCACTAAGGCGCCGG - Intronic
1029602994 7:101580725-101580747 CACGGGCTGCCCTGTGGAGGCGG + Intergenic
1029746200 7:102517086-102517108 CAGGTGCAGGACTGTGGGGGAGG - Intronic
1029764138 7:102616065-102616087 CAGGTGCAGGACTGTGGGGGAGG - Intronic
1030655413 7:112162288-112162310 CAGGCCCTGCAGAGTGGAGGAGG - Intronic
1032125441 7:129189411-129189433 TCCGGCCAGCAGTGTGGAGGTGG - Exonic
1032240904 7:130158092-130158114 CAGGGCCTGGACTGCAGAGGCGG - Intergenic
1034256847 7:149729338-149729360 CCAGGCCAGGAGTGTGGAGGTGG + Exonic
1034490398 7:151390170-151390192 CAGGGCCAGGGCTGCGGAGCAGG + Intronic
1035355746 7:158275176-158275198 CAGGGACAGCACCGTGGCTGTGG + Intronic
1035459300 7:159029446-159029468 GAGCGCCAGCTCTGGGGAGGAGG + Exonic
1036707742 8:11057743-11057765 CAGGAAGAGCATTGTGGAGGAGG - Intronic
1036747260 8:11418606-11418628 CACTGCCATCACGGTGGAGGAGG + Intronic
1037059757 8:14493018-14493040 CAGGGAGAGCACTTTAGAGGTGG - Intronic
1037511272 8:19585857-19585879 GAGGGGCAGCACTGTTGAAGGGG - Intronic
1037543491 8:19894951-19894973 AAGGACCAGCACCGTGGGGGTGG + Intergenic
1037547317 8:19937173-19937195 CAGGGCCAGCGCGGAGCAGGTGG - Intronic
1038122316 8:24631287-24631309 CAGACCTAGGACTGTGGAGGAGG - Intergenic
1038259529 8:25980879-25980901 CAACCCCAGCACTGTGGTGGGGG + Intronic
1039919070 8:41880587-41880609 CAGGGCCAGTTCTTTGCAGGGGG + Intronic
1040621386 8:49096347-49096369 CAGGGCCACCACTTGGGAAGCGG - Intergenic
1040783543 8:51139482-51139504 CAGGGCCAGGGATGTGGTGGAGG - Intergenic
1041082605 8:54227603-54227625 CACCGCCAGCTCTGTGTAGGAGG + Intergenic
1042334565 8:67616412-67616434 CAGGGCCAGAACTATAGAAGTGG + Intronic
1042652320 8:71057012-71057034 CATGGCCAGCAAGGTGGAAGAGG - Intergenic
1044872254 8:96630931-96630953 CAGGGCCAACACTGGGCAGGAGG - Intergenic
1045679848 8:104646926-104646948 TAGTCCCAGCACTTTGGAGGAGG + Intronic
1048801068 8:138194144-138194166 CAGGGCCAGCAGACTGTAGGAGG - Intronic
1049171911 8:141166825-141166847 CAGGGCCAGGGATGGGGAGGGGG + Intronic
1049419300 8:142509973-142509995 CAGGGCCAGGTCTGTGAAGGAGG + Intronic
1049465592 8:142749928-142749950 CAGGGCCATCTCCTTGGAGGAGG - Intergenic
1049465890 8:142751160-142751182 CAGGGCCGGCGCTGGGGAGAAGG + Exonic
1049658324 8:143808647-143808669 AGAGGCCAGCACTGAGGAGGAGG - Exonic
1051372981 9:16374064-16374086 GAGGACCAGCACTGGAGAGGAGG + Intergenic
1051431523 9:16985030-16985052 CAGGGCCAGATATCTGGAGGTGG + Intergenic
1053013434 9:34648212-34648234 CTGAGCCAGCACTGTGGACATGG + Intronic
1053364256 9:37511572-37511594 CAGGGAGAGCTATGTGGAGGTGG + Exonic
1053418367 9:37961103-37961125 CAGGGTAAGCTTTGTGGAGGAGG - Intronic
1053754856 9:41295608-41295630 CAGGGCCTGCTGTGTGGTGGGGG - Intergenic
1054260380 9:62859905-62859927 CAGGGCCTGCTGTGTGGTGGGGG - Intergenic
1056068974 9:82966209-82966231 CACCACCAGCACTGTGAAGGAGG + Intergenic
1056547723 9:87626956-87626978 GAGGGCCAGTACTGGGGAGGAGG + Intronic
1056661397 9:88546313-88546335 CAGGGCCAGCCCAGCCGAGGTGG - Intronic
1056870552 9:90273418-90273440 CAAAGCCAGCACTTTGGAGAAGG + Intergenic
1057062701 9:92019830-92019852 GAGGCCCTGCACTGAGGAGGGGG + Intergenic
1058548352 9:106085667-106085689 CAGGGCCAGAGGTGTGCAGGTGG + Intergenic
1058694544 9:107548227-107548249 CAGGCCCAGAAGTGTGGATGAGG + Intergenic
1058787558 9:108405205-108405227 CAGGGTCTGCACTGAGTAGGTGG - Intergenic
1059313016 9:113401329-113401351 CGTGGCCTGGACTGTGGAGGGGG - Exonic
1059397732 9:114048961-114048983 CAGGGCCAACACTCTGGGAGTGG - Exonic
1060982551 9:127802303-127802325 GAGGCCCAGAACTGGGGAGGAGG - Intronic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061258800 9:129467836-129467858 CTGGGGCTGCACTGAGGAGGTGG - Intergenic
1061574822 9:131499610-131499632 CAGGGCCACCAATGTGTAGTTGG + Exonic
1061753986 9:132799971-132799993 AAGGAACAGGACTGTGGAGGAGG + Intronic
1061783367 9:133008476-133008498 CAGGGCCAGGAATTTGGGGGTGG + Intergenic
1061897989 9:133658464-133658486 CAGGGACAGCATGGAGGAGGGGG - Exonic
1061922049 9:133787791-133787813 CGGGGCCAGGACTGCAGAGGTGG - Intronic
1061989898 9:134153203-134153225 CACGGCCACCTCTGAGGAGGGGG + Intronic
1062049757 9:134441161-134441183 CAGGTCCTGCCCTGTGGTGGTGG + Intergenic
1062183517 9:135203869-135203891 GAGGCCCAGCAGTGGGGAGGCGG + Intergenic
1062240901 9:135537398-135537420 CAGGGCCAGGGCTGAGGATGTGG + Intergenic
1062523915 9:136970651-136970673 CGGGGCCTGCAGTTTGGAGGAGG + Intronic
1062696634 9:137879089-137879111 CAGGGCCAGCACGATGCAGTTGG - Exonic
1202798768 9_KI270719v1_random:153017-153039 CAGGGCCTGCTGTGTGGTGGGGG + Intergenic
1203746499 Un_GL000218v1:43188-43210 CTGGGCCAGCACTGCGGGTGTGG - Intergenic
1203563609 Un_KI270744v1:76292-76314 CTGGGCCAGCACTGCGGGTGTGG + Intergenic
1186786290 X:12959155-12959177 CAGGGGCAGCAGTGAGGAGAAGG - Intergenic
1190499395 X:51059970-51059992 CAGGACCAGAACTGTGGCTGCGG + Intergenic
1191043831 X:56114290-56114312 CAGGGGCAGCACGCTGGAGATGG - Intergenic
1195969272 X:110456125-110456147 CATGGCCAGCACTCTTGATGAGG + Exonic
1196389335 X:115191650-115191672 CAGAGCGACCACTATGGAGGAGG + Exonic
1196816148 X:119666902-119666924 CGGGGCCAGCACCTTGGAGGTGG + Intronic
1198733509 X:139760322-139760344 CAGGCCAAACACTGTGGAGGAGG - Intronic
1200145930 X:153926546-153926568 CAGGGACAGCCTTCTGGAGGTGG - Intronic
1201159829 Y:11158202-11158224 CTGGGCCAGCACTGCGGGTGTGG - Intergenic
1202070745 Y:20989635-20989657 CAGGGGGAGATCTGTGGAGGGGG - Intergenic