ID: 1132115949

View in Genome Browser
Species Human (GRCh38)
Location 15:99136779-99136801
Sequence CTGCTGATGTCCGACAGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132115949 Original CRISPR CTGCTGATGTCCGACAGGCC TGG Exonic
900318636 1:2071417-2071439 CTGCTGGTGTCCTCCAGGCCTGG + Intronic
901235942 1:7667641-7667663 CTGCTAATGTCCCACTCGCCAGG - Intronic
902177507 1:14661932-14661954 TTGCTGAAGTCGGATAGGCCTGG + Intronic
903577498 1:24347801-24347823 TGGCTGCTGTCTGACAGGCCAGG + Intronic
904689913 1:32286113-32286135 CTCCTGATGTGTGCCAGGCCAGG - Exonic
906263067 1:44407583-44407605 CCGCTGGTGGCCGACAGGGCCGG + Intronic
907693619 1:56697399-56697421 CTGCTGATTTCATACAGGCAAGG + Intronic
913057944 1:115179377-115179399 TTGCTGATAGCTGACAGGCCTGG + Intergenic
914375961 1:147073824-147073846 CTGCTGTTGTCAGACATGCCTGG + Intergenic
914505300 1:148283520-148283542 CTGCTGTTGTCAGACGTGCCTGG + Intergenic
914507262 1:148300627-148300649 CTGCTGTTGTCAGACGGGCCTGG - Intergenic
917220814 1:172727166-172727188 CTCCTGTTGTCTGCCAGGCCAGG + Intergenic
924613381 1:245591893-245591915 CTGCTAATGGCCGGCAGGCTTGG - Intronic
1067239206 10:44476170-44476192 CTGGTGATTTCCCACAAGCCTGG - Intergenic
1069886244 10:71625580-71625602 CTGATGCTGCCTGACAGGCCTGG - Intronic
1073479152 10:103775281-103775303 CTGCTGATGTGGTAAAGGCCTGG - Intronic
1074563881 10:114559054-114559076 CAGCTGATGGAGGACAGGCCTGG + Intronic
1075735849 10:124664204-124664226 CTGCTGGTGTCAGGCAGCCCTGG - Intronic
1076317523 10:129552747-129552769 CTGCTGATGTCCGTGAGGACTGG + Intronic
1080120496 11:28671535-28671557 CTGCTGACGTCAGACTGTCCAGG + Intergenic
1081812918 11:45923219-45923241 CCGCAGATGTCCAAGAGGCCGGG - Intronic
1083048427 11:59756012-59756034 CTCCTGAGGTGCTACAGGCCTGG + Intronic
1083163117 11:60867709-60867731 CTGCTGGTGTTCCCCAGGCCAGG + Exonic
1083899745 11:65637984-65638006 GTGCTGACCTCCGCCAGGCCTGG + Intronic
1084615677 11:70234298-70234320 CTGCTGTTGTCTGTCAGGCTAGG + Intergenic
1087789534 11:102391851-102391873 CTGCTGCTGTCTGCCAGGCCAGG - Intergenic
1088824785 11:113484367-113484389 CTGCTGATGTCCCTGAGGCAGGG - Intergenic
1089615529 11:119692635-119692657 CTGCTGATCTGTGCCAGGCCTGG + Intronic
1092178307 12:6426380-6426402 CTGGTGATGTCAGAGAAGCCTGG - Intergenic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1104589661 12:130074234-130074256 ATGATGTTGTCCGACAGGCATGG + Intergenic
1104862393 12:131930313-131930335 CTGCTGCTTTCCATCAGGCCCGG + Intronic
1105543947 13:21338412-21338434 CTGCTGCTGTCAGAGATGCCAGG - Intergenic
1108269923 13:48749371-48749393 TTACTGATGTCAGACAGGCCTGG + Intergenic
1118975235 14:70670973-70670995 CTGCAGACATCCAACAGGCCAGG - Intronic
1120648763 14:87105377-87105399 CTTTTGATGTCAGACTGGCCTGG - Intergenic
1120941737 14:89956069-89956091 CTGCTGGGGTCCGGCAGGGCTGG + Intronic
1121432546 14:93898184-93898206 CTGCTGGGGTCAGAGAGGCCAGG + Intergenic
1122346918 14:101066539-101066561 CTGCTGATGTCGGGGAGGTCCGG + Intergenic
1127775957 15:62264472-62264494 CTTCTAATATCCAACAGGCCAGG + Intergenic
1128562584 15:68678363-68678385 CTGTTATTGCCCGACAGGCCTGG - Intronic
1129333713 15:74840362-74840384 CTGCTGAGGGGCGTCAGGCCAGG - Intronic
1130306549 15:82715484-82715506 GTGCTGCTGTCAGACTGGCCTGG - Intergenic
1131077274 15:89503248-89503270 CTGCTCAAGTCTAACAGGCCAGG + Intergenic
1132072262 15:98788675-98788697 CTGCTGAGGTCTGACAGCTCTGG + Intronic
1132115949 15:99136779-99136801 CTGCTGATGTCCGACAGGCCTGG + Exonic
1133610338 16:7427402-7427424 CTGCTGAAGTTGGACAGGCTTGG + Intronic
1135470945 16:22730110-22730132 CTGCTGATGATCGACAGGGACGG - Intergenic
1137004892 16:35266701-35266723 CTGCTGATGACTCCCAGGCCTGG + Intergenic
1138223766 16:55275305-55275327 CTTCTGAAGTCAGACAGGCCTGG - Intergenic
1138795265 16:59960271-59960293 CTGCTCATGTATGACAGGACAGG + Intergenic
1142123757 16:88400087-88400109 CTGCTGATGAACGGCTGGCCCGG - Intergenic
1144439292 17:15266945-15266967 AGGCTGCTGTCCGTCAGGCCAGG + Intergenic
1144727164 17:17507692-17507714 CTGCTGGGGTCCTACATGCCGGG + Intronic
1145905016 17:28511532-28511554 CTCCTGAAATCCTACAGGCCTGG + Intronic
1147038507 17:37699569-37699591 CTGCTGAGGCCCAGCAGGCCTGG - Intronic
1147440366 17:40443763-40443785 CTGCTGCTGGCCGCCGGGCCCGG + Exonic
1148238192 17:45983246-45983268 CAGCTCATGTCCGGCATGCCTGG + Exonic
1149599021 17:57881503-57881525 CTGCTGCTGTCCCCCAGCCCAGG + Intronic
1151703136 17:75753848-75753870 CCGCTGCTGGCCGACAGGCGCGG - Exonic
1152240263 17:79157248-79157270 GTGCTGATGGACGCCAGGCCAGG - Intronic
1152719667 17:81917202-81917224 CTAGTGATGTCCCACAGCCCAGG + Intronic
1155086330 18:22462849-22462871 CTCCTGATATCCTACAAGCCTGG - Intergenic
1157224137 18:45847379-45847401 CTGCTGATCTCAGAGAGGTCAGG - Intergenic
1160658522 19:287473-287495 CTGCTGATGTCACCGAGGCCAGG - Exonic
1167601479 19:50457524-50457546 GTGCTGGAGTCAGACAGGCCTGG + Intronic
925111513 2:1342273-1342295 CTGCTGCTGTCCTACAGAGCAGG - Intronic
925111593 2:1342728-1342750 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111632 2:1342956-1342978 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111712 2:1343411-1343433 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111751 2:1343638-1343660 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111770 2:1343751-1343773 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111788 2:1343864-1343886 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111807 2:1343977-1343999 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111846 2:1344204-1344226 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111884 2:1344430-1344452 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111902 2:1344543-1344565 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111921 2:1344656-1344678 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925111980 2:1344997-1345019 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925112018 2:1345224-1345246 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925112038 2:1345337-1345359 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925112119 2:1345791-1345813 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925112139 2:1345904-1345926 CTGCTGCTGTCCTACAGAGCTGG - Intronic
925379047 2:3411326-3411348 CGGTTGATTTCTGACAGGCCAGG + Intronic
926158363 2:10470660-10470682 CTGTTGAAGTCAGACAAGCCTGG - Intergenic
931988418 2:67764218-67764240 CTGCTGATATCCCACTGGCTAGG + Intergenic
938140301 2:128789812-128789834 CTGCTGATGTGTGACAGGTCGGG + Intergenic
938246716 2:129782688-129782710 CTGTGGATGTGCGCCAGGCCTGG - Intergenic
938255891 2:129859365-129859387 CTGCTGATGTCCGAGACGAGAGG + Intergenic
938961664 2:136349341-136349363 CTGCTAATGTCCCACAGGACTGG - Intergenic
944184581 2:196932798-196932820 CTGCTGCTGTACTACAGGCTTGG - Intergenic
1169486973 20:6042033-6042055 CTGCTGGTCTCCCGCAGGCCGGG + Exonic
1171006072 20:21467033-21467055 CTGCTGAGGTACACCAGGCCTGG + Intergenic
1171356249 20:24547635-24547657 GGCCTGATGTCCGACAGCCCAGG + Intronic
1171464837 20:25320109-25320131 CTGCTGGTTTCCGGCAGACCGGG + Intronic
1172448695 20:35006739-35006761 CTGGTGAGGTCTGTCAGGCCTGG - Intronic
1175724387 20:61307750-61307772 CTGCTGGTGTCCTGCAGGGCTGG + Intronic
1177693304 21:24538559-24538581 CTTCAGATGTTCAACAGGCCTGG - Intergenic
1178534184 21:33398987-33399009 CTGCTGATGTCCTAGATGGCAGG - Intergenic
1179982951 21:44905927-44905949 CAGCTGGTGTCGGACAGGCTGGG - Intronic
1180908606 22:19432475-19432497 CTGCTGAGGTCCGGCAGACCAGG - Exonic
1180949596 22:19715083-19715105 CAGCTCATGGCCTACAGGCCAGG - Intronic
1183946956 22:41332016-41332038 CAGTTGATTTCCGGCAGGCCTGG + Intronic
1184586298 22:45450339-45450361 CTGCTGGTGTCCCTCAGACCCGG + Intergenic
1184590032 22:45476076-45476098 CTGCTGTTGCCCAACAGTCCCGG + Intergenic
1185139216 22:49090937-49090959 CTGCAGATGCTGGACAGGCCCGG - Intergenic
954384747 3:50238171-50238193 CTGCTGCTGCCCGACGGGCCTGG + Intronic
956891911 3:73622252-73622274 CTGCAGCTGACAGACAGGCCAGG + Intronic
957014278 3:75044522-75044544 CTTCTGCTGTCTGCCAGGCCAGG - Intergenic
958191862 3:90194326-90194348 CTGCTAATGTAGGCCAGGCCAGG + Intergenic
958414082 3:93853458-93853480 CTGCTAATGTAGGCCAGGCCAGG + Intergenic
959426233 3:106192459-106192481 TTGCTGATGGCAGACAGGCTAGG - Intergenic
968061166 3:195727017-195727039 CTGCTGCTCTCTGACAGGCTGGG + Intronic
968694304 4:2014758-2014780 CTGCTAATGTTCAACAGGACTGG - Intronic
973130876 4:46647314-46647336 TTGCTGAAGCCCCACAGGCCTGG + Intergenic
973942033 4:55920823-55920845 CAGCTGAAGTCAGACAAGCCAGG - Intergenic
982217439 4:153094677-153094699 CTCCTGGTGTCCTGCAGGCCTGG + Intergenic
985952216 5:3231023-3231045 CTGCAGATGTTCCAGAGGCCTGG + Intergenic
994620654 5:102157566-102157588 CTGCAGATTTCAGACATGCCTGG - Intergenic
997472050 5:134122611-134122633 CTGCTGAGGTCAGGCAGGTCAGG + Intronic
998057092 5:139087565-139087587 CTGCTGATGGGCTACAGTCCTGG + Intronic
998645927 5:144062018-144062040 CTGTTGATGTCCTACAGGCACGG - Intergenic
999094963 5:148969557-148969579 CAGCTGATGTCCTTCAGGGCAGG - Intronic
999238291 5:150113092-150113114 CTGCCGGGGTCCCACAGGCCTGG + Intronic
1003408141 6:5839968-5839990 CTGCTGCTGTCAGAGATGCCAGG + Intergenic
1005808903 6:29501487-29501509 CTGCTGCTGCCAGACAGGCGCGG - Intergenic
1005831251 6:29672815-29672837 CTGCTGGTGTCTGACCAGCCTGG + Exonic
1006451769 6:34109489-34109511 CTGCTGGTGCCCGGGAGGCCTGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1014541629 6:122683025-122683047 CTGCTCATCTCCCACAGGCAAGG + Intronic
1017141228 6:151191786-151191808 CTGCGCATGTCAGACAGACCTGG - Intergenic
1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG + Intergenic
1019414305 7:920358-920380 CAGCTGATGCCCCACAGGGCTGG + Intronic
1019579011 7:1750951-1750973 CTGCTGGCATCCCACAGGCCAGG + Intergenic
1023816623 7:43955508-43955530 ATGCAAATGTCCAACAGGCCTGG + Exonic
1026462955 7:70631020-70631042 CGGCTGGTGTCCCACAGGCTCGG + Intronic
1029339310 7:99930025-99930047 CAGCTGATGGCTGCCAGGCCTGG + Intergenic
1035372423 7:158387876-158387898 CTGCAGATGTCAGACCCGCCAGG + Intronic
1036805913 8:11833318-11833340 ATTCTGATGTCAGACAGACCTGG - Intronic
1037767509 8:21781174-21781196 CTGCTGCTGTGATACAGGCCAGG - Intronic
1040092385 8:43411034-43411056 CTGCTGTTGCCTGTCAGGCCAGG - Intergenic
1048317139 8:133370760-133370782 CTGCTGGCATCCCACAGGCCAGG + Intergenic
1054929008 9:70617257-70617279 CTGCTGGTGACCGCCAAGCCCGG - Intronic
1056766658 9:89448376-89448398 CTGCTGATGCCCCACTGCCCAGG + Intronic
1058568429 9:106312603-106312625 CTCCTGATGACTGATAGGCCAGG - Intergenic
1060998168 9:127886572-127886594 CTCCTGAGGTCCCACAGGCTGGG + Exonic
1186477109 X:9866052-9866074 CTGCTGTGGTCCCAGAGGCCAGG - Intronic
1187360349 X:18620640-18620662 CTGCTGCTGTCCTACAGGCCGGG - Intronic
1195919053 X:109964294-109964316 CTACTTATGTCCTACTGGCCAGG + Intergenic
1196950906 X:120875144-120875166 CTGCTGCTGTCCCAGAGGCTGGG - Exonic
1202276042 Y:23120346-23120368 CTGCAGAAGTCTTACAGGCCAGG + Intergenic
1202289986 Y:23300345-23300367 CTGCAGAAGTCTTACAGGCCAGG - Intergenic
1202429035 Y:24754065-24754087 CTGCAGAAGTCTTACAGGCCAGG + Intergenic
1202441756 Y:24916024-24916046 CTGCAGAAGTCTTACAGGCCAGG - Intergenic