ID: 1132115950

View in Genome Browser
Species Human (GRCh38)
Location 15:99136780-99136802
Sequence TGCTGATGTCCGACAGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132115950 Original CRISPR TGCTGATGTCCGACAGGCCT GGG Exonic
900318637 1:2071418-2071440 TGCTGGTGTCCTCCAGGCCTGGG + Intronic
902177508 1:14661933-14661955 TGCTGAAGTCGGATAGGCCTGGG + Intronic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903330891 1:22596576-22596598 TGCTGATTCCCACCAGGCCTGGG + Intronic
903577499 1:24347802-24347824 GGCTGCTGTCTGACAGGCCAGGG + Intronic
904138643 1:28334142-28334164 TGCTCATCTCCAGCAGGCCTGGG - Intronic
904367970 1:30028932-30028954 TGCTAAAGTCAGACAGTCCTGGG - Intergenic
907040461 1:51254327-51254349 TGCCAATGTACTACAGGCCTGGG - Intronic
909295910 1:73948562-73948584 TGCTAGTGTCCCACAGGCCCTGG - Intergenic
909556225 1:76957262-76957284 TGGTGATTGCCGACAGTCCTTGG + Intronic
913685442 1:121227502-121227524 TGCTAATGTCAGAGAGACCTGGG + Intronic
914037289 1:144015106-144015128 TGCTAATGTCAGAGAGACCTGGG + Intergenic
914152166 1:145052826-145052848 TGCTAATGTCAGAGAGACCTGGG - Intronic
914435353 1:147654606-147654628 TGCTGTTTTCAGACAGACCTGGG - Intronic
918094530 1:181323871-181323893 TGCTGAAGTCTGAGAGTCCTAGG + Intergenic
919931678 1:202225271-202225293 TGCTGTTGTCAGACTGGCTTTGG + Intronic
920472760 1:206246060-206246082 TGCTAATGTCAGAGAGACCTGGG + Intronic
924613380 1:245591892-245591914 TGCTAATGGCCGGCAGGCTTGGG - Intronic
1064145339 10:12822372-12822394 TGCTCATTTCCCACAGTCCTGGG - Intronic
1072994929 10:100234914-100234936 TTTTGAGGTCCAACAGGCCTGGG + Intronic
1075563059 10:123482384-123482406 TTCTGGAGTCTGACAGGCCTGGG + Intergenic
1075735848 10:124664203-124664225 TGCTGGTGTCAGGCAGCCCTGGG - Intronic
1076317524 10:129552748-129552770 TGCTGATGTCCGTGAGGACTGGG + Intronic
1077341152 11:2026956-2026978 TGCTGCTCTCCCAGAGGCCTTGG - Intergenic
1078156003 11:8800622-8800644 TGCTGAGCCCAGACAGGCCTAGG - Intronic
1079098008 11:17523292-17523314 TGCTGTGGTCTGTCAGGCCTCGG - Intronic
1079983520 11:27176845-27176867 TCCTGATGTTAGACAGACCTGGG + Intergenic
1080876389 11:36278767-36278789 TGCTCATGCCCCACATGCCTTGG + Intronic
1085407483 11:76272059-76272081 TCTTGATGTCAGACAGTCCTGGG - Intergenic
1087789533 11:102391850-102391872 TGCTGCTGTCTGCCAGGCCAGGG - Intergenic
1089615530 11:119692636-119692658 TGCTGATCTGTGCCAGGCCTGGG + Intronic
1202824137 11_KI270721v1_random:82145-82167 TGCTGCTCTCCCAGAGGCCTTGG - Intergenic
1092178306 12:6426379-6426401 TGGTGATGTCAGAGAAGCCTGGG - Intergenic
1094196067 12:27751366-27751388 TGCTGAAGTCCGAGGGGCGTGGG + Intronic
1096391759 12:51235095-51235117 TGATGATGGCAGACTGGCCTAGG - Intergenic
1101988585 12:109466559-109466581 TGTTGATGTTAGCCAGGCCTGGG - Intronic
1104178077 12:126351899-126351921 AGCTGAGGTCACACAGGCCTGGG - Intergenic
1104589662 12:130074235-130074257 TGATGTTGTCCGACAGGCATGGG + Intergenic
1104641867 12:130472114-130472136 TGGTGATGTCGGGGAGGCCTTGG + Intronic
1104661954 12:130617462-130617484 TGCTGTGGCCCCACAGGCCTAGG + Intronic
1108269924 13:48749372-48749394 TACTGATGTCAGACAGGCCTGGG + Intergenic
1114267614 14:21081979-21082001 TGCTGGTGACCTCCAGGCCTCGG - Exonic
1115327844 14:32162181-32162203 TGATGGTGTCCTACAGGCATAGG + Intergenic
1115506261 14:34097040-34097062 TTCTGATCTCCAACAGGTCTTGG - Intronic
1116898806 14:50342329-50342351 TGCTGTTGTCCAACAGGCCAAGG - Intronic
1118751210 14:68808908-68808930 TGATGTTGTCTGCCAGGCCTGGG - Intergenic
1119433095 14:74581112-74581134 TGGGGATGTCAGACAGGCTTTGG + Intronic
1121665216 14:95666843-95666865 GGCTGGTGTCCCACAGGCCTTGG + Intergenic
1122150253 14:99721802-99721824 GGCTGATGTCCCAGGGGCCTGGG + Intronic
1125753172 15:42044444-42044466 TGATGAGGTCAGAGAGGCCTTGG + Intronic
1126534175 15:49742553-49742575 TGGTGAAGTCTGCCAGGCCTGGG - Intergenic
1128562583 15:68678362-68678384 TGTTATTGCCCGACAGGCCTGGG - Intronic
1129407537 15:75329106-75329128 GTCTGATGTAAGACAGGCCTTGG - Intergenic
1129869661 15:78932306-78932328 TCCTGATGTGGGCCAGGCCTGGG - Intronic
1130306548 15:82715483-82715505 TGCTGCTGTCAGACTGGCCTGGG - Intergenic
1132072263 15:98788676-98788698 TGCTGAGGTCTGACAGCTCTGGG + Intronic
1132115950 15:99136780-99136802 TGCTGATGTCCGACAGGCCTGGG + Exonic
1132206414 15:99989008-99989030 TGCTGAGGACAGCCAGGCCTTGG + Intronic
1132331750 15:101016717-101016739 GGCTGAAGTCCCACAGTCCTGGG - Intronic
1133133048 16:3689902-3689924 TGCTGAGGCCAGACATGCCTCGG + Intronic
1133204312 16:4223915-4223937 AGCTGATGTCCATCAGCCCTAGG + Intronic
1133724056 16:8521074-8521096 TGCTGGTGTCTGACAGGCCAAGG - Intergenic
1135669299 16:24361647-24361669 TGCTGATGGGGGACAGGTCTCGG - Exonic
1137004893 16:35266702-35266724 TGCTGATGACTCCCAGGCCTGGG + Intergenic
1138223765 16:55275304-55275326 TTCTGAAGTCAGACAGGCCTGGG - Intergenic
1138865618 16:60815691-60815713 TGCTGATGTCCCACTGGCCAAGG - Intergenic
1142504531 17:354448-354470 TGCGGGTCTCCCACAGGCCTTGG - Intronic
1143384903 17:6523402-6523424 TGCTGGAGTCAGAGAGGCCTGGG - Intronic
1144310606 17:14010821-14010843 TGCTAATGTCCCACTGGCCAAGG + Intergenic
1145905017 17:28511533-28511555 TCCTGAAATCCTACAGGCCTGGG + Intronic
1148238193 17:45983247-45983269 AGCTCATGTCCGGCATGCCTGGG + Exonic
1150914684 17:69424562-69424584 TTCTGAGGTCAGACAGACCTTGG - Intronic
1152240262 17:79157247-79157269 TGCTGATGGACGCCAGGCCAGGG - Intronic
1157004549 18:43566404-43566426 TGCTGGTGTATCACAGGCCTTGG + Intergenic
1157185416 18:45536449-45536471 TGCTGATGGCCGGCAGTCCTTGG + Intronic
1159870061 18:73751042-73751064 TGCTGGAGTCAGATAGGCCTGGG - Intergenic
1160812048 19:1017163-1017185 GGCTGATGACAGACAGGTCTTGG - Intronic
1164451762 19:28372206-28372228 TGCTGATGGCTGGCAGCCCTAGG + Intergenic
1166000577 19:39875314-39875336 GGCTGCTGTCCTACAGTCCTGGG + Intronic
1166003375 19:39891569-39891591 GGCTGCTGTCCTACAGTCCTGGG + Intronic
1167601480 19:50457525-50457547 TGCTGGAGTCAGACAGGCCTGGG + Intronic
925111592 2:1342727-1342749 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111631 2:1342955-1342977 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111711 2:1343410-1343432 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111750 2:1343637-1343659 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111769 2:1343750-1343772 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111787 2:1343863-1343885 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111806 2:1343976-1343998 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111845 2:1344203-1344225 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111883 2:1344429-1344451 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111901 2:1344542-1344564 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111920 2:1344655-1344677 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925111979 2:1344996-1345018 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112017 2:1345223-1345245 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112037 2:1345336-1345358 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112118 2:1345790-1345812 TGCTGCTGTCCTACAGAGCTGGG - Intronic
925112138 2:1345903-1345925 TGCTGCTGTCCTACAGAGCTGGG - Intronic
926382107 2:12301239-12301261 TGCTGAGGTCAGGCAGGGCTAGG + Intergenic
927078966 2:19609199-19609221 TGCTGATGACAGACAGGAATAGG + Intergenic
928436167 2:31255889-31255911 GGCTGCTGTCTTACAGGCCTCGG - Intronic
931021653 2:58051730-58051752 TGCTGATTACCGAAAGGCCCTGG - Intronic
933022377 2:77210116-77210138 TGCTGATTTCTGACACGCCAAGG + Intronic
935839858 2:107097575-107097597 TCCTGGTGGCCGGCAGGCCTGGG + Intergenic
937875531 2:126822793-126822815 TTCTGGTGTCCGAGAAGCCTGGG - Intergenic
938140302 2:128789813-128789835 TGCTGATGTGTGACAGGTCGGGG + Intergenic
938743854 2:134258874-134258896 TGCTCATGTCTCACAGTCCTTGG - Intronic
942373209 2:175308542-175308564 TACTTATGTCCTGCAGGCCTGGG - Intergenic
1171006073 20:21467034-21467056 TGCTGAGGTACACCAGGCCTGGG + Intergenic
1173077979 20:39839143-39839165 TGTTGGTGTCAGATAGGCCTCGG + Intergenic
1177693303 21:24538558-24538580 TTCAGATGTTCAACAGGCCTGGG - Intergenic
1179815892 21:43905975-43905997 TGCTGATGCCTGACGCGCCTTGG - Intronic
1181549896 22:23631834-23631856 TGCTGATGTGCTGCAGGTCTTGG + Exonic
1181798496 22:25327698-25327720 TGCTGATGTGCTGCAGGTCTTGG - Intergenic
1183946957 22:41332017-41332039 AGTTGATTTCCGGCAGGCCTGGG + Intronic
953176053 3:40553174-40553196 TGTTGCTTTCTGACAGGCCTAGG - Intronic
954384748 3:50238172-50238194 TGCTGCTGCCCGACGGGCCTGGG + Intronic
959426232 3:106192458-106192480 TGCTGATGGCAGACAGGCTAGGG - Intergenic
962267753 3:133955590-133955612 TGCTGGAGGCCGACGGGCCTGGG - Intronic
962480816 3:135796649-135796671 TCCTGATGTCAGAGATGCCTGGG + Intergenic
965705439 3:171501553-171501575 TGCTAATGTCCCACAGGACAAGG + Intergenic
965990608 3:174812723-174812745 TGCTGATCTCGTATAGGCCTAGG + Intronic
968750795 4:2387877-2387899 TCCTGCTGTCCGACAGTCTTTGG - Intronic
971475037 4:27064882-27064904 TGCTGAAGTCCCACACACCTTGG + Intergenic
973239649 4:47944027-47944049 TTCTGAAGTCAGACAGACCTAGG + Intronic
975669279 4:76764337-76764359 TTCTGAAGTCCAACAGGCTTTGG + Intronic
976195540 4:82528397-82528419 TGCTGATGTGCTCCTGGCCTGGG + Intronic
985861922 5:2478009-2478031 TGCTGATGGCTGAGAGGCCCAGG - Intergenic
987489331 5:18556501-18556523 TGCTACTGTGCGTCAGGCCTAGG + Intergenic
990902820 5:60771538-60771560 CTCTGATGTCAGACAGACCTGGG + Intronic
995543764 5:113209504-113209526 TCCTGATTTCCGGCAGGCTTTGG + Intronic
998340735 5:141415194-141415216 TGCCGAGGTCCGCCAGGACTTGG - Exonic
998342819 5:141432766-141432788 TGCCGAGGTCCGCCAGGACTTGG - Exonic
998645926 5:144062017-144062039 TGTTGATGTCCTACAGGCACGGG - Intergenic
999238292 5:150113093-150113115 TGCCGGGGTCCCACAGGCCTGGG + Intronic
999786020 5:154891359-154891381 TGCTGAAGTCCAAGAGACCTTGG - Exonic
1000172702 5:158718691-158718713 CTCTGATGTCTAACAGGCCTGGG - Intronic
1001879876 5:175234111-175234133 TGCTGATGTGACACAGGGCTGGG + Intergenic
1002100615 5:176855798-176855820 TGCTGGTGCCCAGCAGGCCTTGG - Intronic
1006459008 6:34147307-34147329 TGCTGAGGTCCGAATGGCCACGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1013125983 6:107184671-107184693 TGCTGATGTCTGAGAGGCATTGG + Intronic
1013479871 6:110544200-110544222 TGCTGTTGTCTGGCAGCCCTAGG - Intergenic
1019414306 7:920359-920381 AGCTGATGCCCCACAGGGCTGGG + Intronic
1021850554 7:24804103-24804125 TGCTGACTTCAGACAGGACTAGG - Intronic
1022374023 7:29796739-29796761 TGCTGCTGTCCCAGAGGGCTCGG - Intergenic
1032570979 7:132996678-132996700 TGCTGATTAGCGACAGGGCTTGG - Intronic
1032643800 7:133798673-133798695 GTCTGAGGTCAGACAGGCCTGGG - Intronic
1034627524 7:152504785-152504807 TGCTGGTGTCAGCCAGGACTTGG + Intergenic
1035030208 7:155852035-155852057 TGCTGTTGTGGCACAGGCCTAGG - Intergenic
1036805912 8:11833317-11833339 TTCTGATGTCAGACAGACCTGGG - Intronic
1038246297 8:25859475-25859497 TGCTGATGCCCCAAAGTCCTAGG - Intronic
1044080864 8:87881628-87881650 TGATGTTGTCTGACAAGCCTGGG + Intergenic
1050914026 9:11108480-11108502 TGGTGATGTCCCCCAGGCCCTGG - Intergenic
1059910289 9:119035964-119035986 TGCTGTTGTCCGTGTGGCCTTGG + Intergenic
1060744340 9:126120359-126120381 GGCTGTTGTCTGATAGGCCTGGG - Intergenic
1188670233 X:32873132-32873154 TCCTGAGGACCTACAGGCCTGGG - Intronic
1190561675 X:51692387-51692409 TGCTGATGTCAGACACAGCTTGG - Intergenic
1190562616 X:51700918-51700940 TGCTGATGTCAGACACAGCTTGG + Intergenic
1192152723 X:68722116-68722138 TGATCATGTGCGACAGGCCCTGG - Exonic
1194331606 X:92590485-92590507 TGCTGTTGACCCACAGGGCTTGG + Intronic
1198417342 X:136434047-136434069 TGCTGATGTTCAACAGGAGTTGG - Intergenic
1200640312 Y:5709541-5709563 TGCTGTTGACCCACAGGGCTTGG + Intronic