ID: 1132116181

View in Genome Browser
Species Human (GRCh38)
Location 15:99138046-99138068
Sequence CAGGGTGTCCTGAGGGATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132116167_1132116181 15 Left 1132116167 15:99138008-99138030 CCTCAGTCTGCTGTTGTGCCGGG 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG 0: 1
1: 0
2: 1
3: 21
4: 285
1132116174_1132116181 -8 Left 1132116174 15:99138031-99138053 CCGGGCCTTCCCCAGCAGGGTGT 0: 1
1: 1
2: 3
3: 33
4: 308
Right 1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG 0: 1
1: 0
2: 1
3: 21
4: 285
1132116171_1132116181 -3 Left 1132116171 15:99138026-99138048 CCGGGCCGGGCCTTCCCCAGCAG 0: 1
1: 0
2: 4
3: 47
4: 373
Right 1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG 0: 1
1: 0
2: 1
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132116181 Original CRISPR CAGGGTGTCCTGAGGGATGC TGG Exonic
900377226 1:2360662-2360684 CAGGGCCTCCTGCGGGCTGCAGG - Intronic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
900727200 1:4224503-4224525 CAGGGAGTCCTGGAGGATCCAGG + Intergenic
900966010 1:5959133-5959155 CATGGTGTCCGGAGGGAGGGAGG - Intronic
901059025 1:6463139-6463161 GGGGGTGGCCTGAGGGATGAGGG + Exonic
901741372 1:11344176-11344198 CAGGTAGTCCTCAGGGAGGCAGG + Intergenic
901757102 1:11448084-11448106 CAGGGCGGCCTGAGGGCTGGGGG + Intergenic
901866248 1:12108932-12108954 CAAGGAGTCCTGAAGAATGCTGG - Intronic
902292915 1:15446861-15446883 CAGGGAGTCCTGCGTGAAGCCGG + Intronic
903295933 1:22343053-22343075 CCAGGTGTCCCGAGGGCTGCTGG - Intergenic
903684368 1:25120146-25120168 GAGGGTGTGCTCAGGGATCCTGG - Intergenic
903828521 1:26161472-26161494 CTGGGCGTCCTGGGCGATGCAGG - Exonic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
905201512 1:36319958-36319980 CAGGGTCTCCTCTGGGATGATGG - Exonic
905231259 1:36516127-36516149 CAGGGGGTTCTAAGGCATGCAGG - Intergenic
905370252 1:37479241-37479263 CTGGATTTCCTGAGGGATGGGGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
905975170 1:42169013-42169035 CAGGGAGTCCTTTGGGATCCTGG - Intergenic
907550226 1:55298820-55298842 TAGGGTGTAGAGAGGGATGCTGG + Intergenic
909349158 1:74629454-74629476 CATGGTGTCATCAGGCATGCTGG - Intronic
910944689 1:92577475-92577497 CAGGCTGTCTTGAGGAAAGCTGG + Intronic
911163248 1:94702523-94702545 CAGGGCCTCCTGAGGAAGGCTGG - Intergenic
913530991 1:119734202-119734224 CAGGGAGTCCTGAGGGAGGGAGG - Intronic
916616760 1:166449505-166449527 CTGAGTGTCCTGAAGGATACTGG - Intergenic
917794395 1:178522134-178522156 CAGGGTGTCTTGGGTGATGCAGG + Intronic
918243124 1:182637421-182637443 CAGGGTGTTGTCAGGGGTGCTGG - Intergenic
918447971 1:184633513-184633535 CGGCGTGTTCTGAGGGATGGGGG - Intergenic
919742422 1:200988998-200989020 CAAGGTGTCTTGAGGGGTGCAGG - Intronic
919877833 1:201883481-201883503 CATGGAGTCCCCAGGGATGCTGG + Exonic
919949798 1:202352473-202352495 CTGAGTGTGGTGAGGGATGCTGG + Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
1063378568 10:5569960-5569982 GAGAGTGTCCTGGGGGATCCTGG - Intergenic
1063459801 10:6207910-6207932 CTGTGTGTTCTGAGGGATCCTGG + Intronic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1065478814 10:26171508-26171530 GAGGTTGGCCTGAGGGATTCAGG - Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1070777496 10:79118401-79118423 GAGAGTGTCCTGTGGGAAGCGGG + Intronic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1072782636 10:98260962-98260984 CAGGGTGGTGTGCGGGATGCTGG - Exonic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074492853 10:113954888-113954910 CAGGAAGGCCTGAGTGATGCAGG - Intergenic
1074870196 10:117570112-117570134 CAGGGTTTCCTGAGAGGAGCTGG - Intergenic
1075528204 10:123203415-123203437 CAGGGGGTCCTGAGGGACAGAGG + Intergenic
1075679648 10:124323106-124323128 CAGGGGGTCCTCAGAGATGGTGG - Intergenic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077584894 11:3443734-3443756 CTGGGTGTCTTGATGGATTCTGG + Intergenic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1080636697 11:34130691-34130713 AAGGCTGTCCTGGGGGAAGCAGG + Intronic
1080763224 11:35272644-35272666 CAGGGTTTCCTGAGTGGTGAGGG - Intronic
1081572228 11:44298771-44298793 CAGGGTTTCCTGTGGGGTGTAGG - Intronic
1081742122 11:45448163-45448185 CAGGGTCCCCTGTGGGGTGCAGG - Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1082959205 11:58902803-58902825 CACTCTGTCCTCAGGGATGCTGG + Intronic
1083592617 11:63904411-63904433 CAGGGTTTCCTTAGGGACCCCGG + Intronic
1083628015 11:64081904-64081926 CCGGGAGTCCAGAGGGCTGCAGG - Intronic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1084604851 11:70166471-70166493 CAGGGTTTCCAGATGGAGGCTGG + Intronic
1085875021 11:80396027-80396049 TAAGGTGTCCTGAAGGCTGCAGG + Intergenic
1088550730 11:111009958-111009980 CAGGGTGGATTGAGGGATGGGGG + Intergenic
1088721485 11:112596041-112596063 TATGGTGACCTCAGGGATGCTGG + Intergenic
1089248252 11:117137978-117138000 CAGGGTGACCTGCGGGGTGAAGG + Intergenic
1089258459 11:117206583-117206605 CAGGGTGACCTGCGGGGTGAAGG - Intronic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1090173574 11:124626540-124626562 CAGGCCGTCCTGAGGGATCCAGG - Exonic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1091799098 12:3313572-3313594 CAGGGTGTCAGGAGGGGTGAGGG + Intergenic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1094221696 12:28000936-28000958 CAGGGCAGCCTGAGGGCTGCTGG + Intergenic
1094359560 12:29615619-29615641 CTGGGAGTCCTGATGGATGAGGG - Intronic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1095985126 12:47994250-47994272 CAGGCTCTCATGAGGGAGGCTGG - Intronic
1096179055 12:49540611-49540633 GAGGGTGTCCTGAGCAATGTGGG - Intronic
1097747272 12:63315223-63315245 CAGACTGTCCCTAGGGATGCTGG - Intergenic
1097963777 12:65557731-65557753 CAGAGAGCCCTGAGGGCTGCTGG - Intergenic
1098167231 12:67710891-67710913 CAGGGTGTGCTGTGGGAGCCAGG + Intergenic
1100178361 12:92056747-92056769 CAGGGTCTGTTGAGGGATGAAGG - Intronic
1101701672 12:107179649-107179671 CAGGGTCCTCTGTGGGATGCTGG - Intergenic
1102704508 12:114869578-114869600 CAGGGTGTCCTGTGGCTTGAAGG - Intergenic
1102742870 12:115223549-115223571 CAGGGTGGCCTGGAGGAAGCTGG + Intergenic
1103136390 12:118511405-118511427 CTGGGTGTGCTGAGTGATGGTGG + Intergenic
1103209397 12:119155438-119155460 CAGGGTGCCCTGTGGGATATTGG - Intronic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1104756097 12:131270169-131270191 CAGGCTGTCATGGGGGATGATGG + Intergenic
1105756349 13:23467461-23467483 AAGGGTGTCCTGAGTGAGGGTGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1108799128 13:54071023-54071045 TAGGGTGTACTGAGGGGTGGGGG + Intergenic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113931578 13:113971655-113971677 CAGGGAGGCCTCCGGGATGCGGG - Intergenic
1115884614 14:37957698-37957720 GAGGATGTCCTGAGGGCTGCAGG - Intronic
1117660912 14:58003663-58003685 CGGGGTGCCCTGAGAGAGGCTGG + Exonic
1119484032 14:74976892-74976914 CACGGTGTGCTGAGGGCTGGAGG - Intergenic
1121472063 14:94163784-94163806 CAGGGTATACTGAGGGCTTCTGG - Intronic
1122153906 14:99738935-99738957 CAGGGTCTCCTGGGGGGTGTGGG + Intronic
1123167728 14:106342576-106342598 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123170354 14:106367287-106367309 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123194032 14:106599551-106599573 CTTGGTGTCCTGAGGAATCCTGG + Intergenic
1125600041 15:40910516-40910538 CAGGGTGCAGTGGGGGATGCTGG - Intergenic
1126119146 15:45235811-45235833 CAGGGTCTACTGAGGGAAACAGG + Intergenic
1127715184 15:61642939-61642961 CAGGCTGTCCTGATGAATGGAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129910949 15:79225811-79225833 AAGGGTGTTTTCAGGGATGCTGG + Intergenic
1129969913 15:79769179-79769201 CAGGCGGCCCTGAGGGATGGAGG - Intergenic
1130322849 15:82854877-82854899 AGGGGTGTGCTGAGGGATGGCGG - Intronic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130923398 15:88367384-88367406 CAGGGAGTTCTGGGGGACGCAGG - Intergenic
1131416753 15:92266581-92266603 CATTGTGTCCTGAGGGCTTCTGG - Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132508347 16:324033-324055 CAGGGTTTCCTGTGGGCTACGGG - Intronic
1132565014 16:618097-618119 CTGGATGTCCTGAGGGGAGCGGG - Intronic
1133011105 16:2912226-2912248 CCGGGGGTCCCGAGGGTTGCGGG + Intronic
1134126983 16:11622677-11622699 CAAGGTGTCGTGAAGGATACTGG + Intronic
1135505927 16:23036186-23036208 CTGGATGTCTTGAGAGATGCTGG - Intergenic
1136453460 16:30367955-30367977 CAGGCTGTCCTGAGGAACTCGGG - Intronic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1137516282 16:49147375-49147397 CAGGGAGTAATGAGGGATGGAGG + Intergenic
1137794387 16:51203031-51203053 GAAGGTGTTCTGAGGGAGGCAGG - Intergenic
1139181822 16:64757633-64757655 CAAGATGTACTGAAGGATGCTGG + Intergenic
1139936943 16:70578356-70578378 CAGGTTTTCCTGAGGGACACAGG - Intergenic
1140288008 16:73622749-73622771 CAGGGTGCCCTTAGAGCTGCTGG - Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1140861909 16:79025526-79025548 CAGGGAGCACTGAGGGCTGCTGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141674421 16:85510114-85510136 CAGGGAGCCCTGAGGGCTCCAGG - Intergenic
1141734023 16:85840379-85840401 CAAGGTGTCCTGAGCCATGCTGG + Intergenic
1141951503 16:87342879-87342901 CAGGATGTCCGGCGGGAGGCAGG - Exonic
1142093163 16:88225948-88225970 CAGGGTGTCCTGAGACAGCCAGG - Intergenic
1143471598 17:7179107-7179129 CAGGGTGTGTTGGGGGGTGCTGG - Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1147402429 17:40189002-40189024 CAGGGTGTCCTGAGTGGCTCAGG + Intronic
1147988961 17:44321870-44321892 CAGGGAGGCCTGAGGGCTGTGGG - Intronic
1148215263 17:45830650-45830672 CTGGGGGGCCTGAGGGATGGAGG + Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1152021891 17:77784081-77784103 CCGGGTGCCCGGACGGATGCTGG + Intergenic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1152176011 17:78787988-78788010 CAAGGTGTCCTCAGGGCTGTGGG - Intronic
1152491902 17:80640670-80640692 CAGGATGTTGTGAGGGATGCAGG + Intronic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154331265 18:13430781-13430803 CAGGTTGTCCAGAGGCCTGCAGG + Intronic
1160390121 18:78523716-78523738 GAGGATGTCCTGAGGCTTGCTGG + Intergenic
1160425183 18:78774233-78774255 CAGGGTGTGCTTAGGGAGTCAGG + Intergenic
1160506820 18:79432032-79432054 CAGTGTGTCCTGAGGTGTGGGGG + Intronic
1160662325 19:306841-306863 CGGGGTGCCCTGAGGGGAGCTGG + Intronic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161379631 19:3958277-3958299 CACGGTGTCCTGGGAGCTGCCGG - Intergenic
1163267345 19:16228984-16229006 CAGGGGGTCCTGAGGCACCCAGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166105356 19:40595454-40595476 CAGGGGGTCCTGGGGGCTCCTGG + Intronic
1166381481 19:42357390-42357412 CTGGGGGGCCTGAGGGATGGAGG - Exonic
1167146057 19:47681236-47681258 CAGGGAGTCCTGAGTGAGGATGG - Exonic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
1168488819 19:56790016-56790038 CAGGGTGGCATGAGGGTGGCTGG - Intronic
925034394 2:674566-674588 GAGGGTGCCCTGAGGAGTGCTGG - Intronic
925290468 2:2744951-2744973 CAGGATGTCCTCAGAGATACTGG - Intergenic
925599051 2:5589390-5589412 CAGGGGGTGCTGAGCGAGGCTGG + Intergenic
926158754 2:10473511-10473533 CAGGGTGTCCTGAGGACTCATGG + Intergenic
926210070 2:10862894-10862916 ATGAGGGTCCTGAGGGATGCAGG + Intergenic
927143377 2:20144733-20144755 CTGGGTGGCCTGAGGAGTGCAGG - Intergenic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
930764756 2:55073921-55073943 CAGGTGGTCCTGAGGGAGGGTGG - Intronic
932330817 2:70897451-70897473 GAGGGTGTACTGGGGGATGTAGG - Intergenic
934581265 2:95441807-95441829 TAGGGTGCCCTTAGGGAAGCTGG - Intergenic
934598185 2:95634907-95634929 TAGGGTGCCCTTAGGGAAGCTGG + Intergenic
936891726 2:117378519-117378541 TAAGGTGACGTGAGGGATGCTGG + Intergenic
937043958 2:118841372-118841394 CAGGGTGTCCTGAGGGCCCTGGG + Intergenic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
941501637 2:166285769-166285791 CAGGGAGGCCTGAGAGATGAAGG + Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943220853 2:185104272-185104294 GAGTCTGTCCTGAGAGATGCTGG + Intergenic
944671227 2:201996070-201996092 CAGGCTCTCCCGAGGGAGGCAGG + Intergenic
947973370 2:234343421-234343443 CAAGGTCTCCTGAGGGACACAGG - Intergenic
948154657 2:235771449-235771471 CAGGGTGACCTAAGGCATGTGGG + Intronic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
948912438 2:241011218-241011240 CTGGGTCTCCTGGGGGTTGCAGG + Intronic
1169014358 20:2279659-2279681 CAGCCTGCCCTGAGGGATTCTGG - Intergenic
1169026547 20:2376336-2376358 GAGGATGTCTTGAGGGATTCAGG - Intergenic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1170884574 20:20329142-20329164 CAGTATGTCCTGAGGGGTGGTGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172567743 20:35944181-35944203 GAGGGTGGCCTGCTGGATGCTGG + Intronic
1173020579 20:39264667-39264689 CAGGCTTTTCTGTGGGATGCAGG - Intergenic
1173564618 20:44029965-44029987 AAGGGTGGCCTGAGGGGTGGAGG - Intronic
1173884037 20:46441148-46441170 CAGGGCACCATGAGGGATGCTGG - Intergenic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174292374 20:49518123-49518145 AAGGGAGACCTGAGGGATGGGGG + Intronic
1174934825 20:54855861-54855883 CTGGCTGTCCTGAGGGATAGTGG + Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1175789228 20:61731235-61731257 GAGGGTCTCCTGAGGGATTTTGG + Intronic
1177223626 21:18224898-18224920 CAGGGCGGCCTTAGGGAGGCTGG + Intronic
1177612165 21:23465926-23465948 CATAATGTCCAGAGGGATGCTGG + Intergenic
1179816582 21:43909954-43909976 CAGGGTGTCCTGGGGCACCCTGG - Intronic
1179912743 21:44459082-44459104 CAGCGTGGCGTGAGGGAAGCAGG - Exonic
1179951948 21:44713185-44713207 CAGGGGGTCCTGGGGGGTGAGGG - Intergenic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1180950238 22:19717531-19717553 CAGGGCCACCTGAGGGCTGCAGG + Intronic
1181029197 22:20141764-20141786 CAGGGTGTCCTGGGAGGGGCTGG + Intronic
1182299733 22:29330848-29330870 GAGGGTGTGCTTAGGGAAGCAGG - Intronic
1183279887 22:36926288-36926310 GAGGGTTTCTTGAGGGATGAGGG + Intronic
1183460082 22:37944539-37944561 CAGGTTCCCATGAGGGATGCAGG + Intronic
1183529646 22:38346529-38346551 CAGGGAGTCCTGAGGGCCGTGGG + Intronic
1184248157 22:43246011-43246033 CAGGGAGGCCTGAGGGCTGGTGG + Intronic
1184266441 22:43349409-43349431 CTGGGAGTCCTGAGAGAAGCAGG - Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184916235 22:47570873-47570895 GTGGGTGTCCTGAGGAATGGTGG + Intergenic
1185041285 22:48505733-48505755 GAGGGTGGTCTCAGGGATGCTGG - Intronic
949459675 3:4276949-4276971 CAGGATGTTCTGAGGGAAGATGG + Intronic
949950182 3:9222417-9222439 CAGGGTGTCTTGTGGAATCCAGG - Intronic
950716718 3:14853046-14853068 CAGGGTTTCCTGAGGAATCCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953196823 3:40742210-40742232 CAGAGTGTCCTGAGAGGGGCTGG - Intergenic
953901306 3:46845686-46845708 CAGGGTGTCCCGGGAGCTGCGGG + Intergenic
955124218 3:56094324-56094346 CAGGTTGCCCTGGGGAATGCAGG - Intronic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
958140761 3:89559491-89559513 CAGAGTCACCTGAGGAATGCAGG - Intergenic
958992298 3:100860856-100860878 CAGGTGCTCCTGAGGGATGTGGG + Intronic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961523460 3:127481824-127481846 AGGGGTGGCCTGAGAGATGCTGG + Intergenic
962864904 3:139440333-139440355 CAGTCTGTCCTGAGGTATGGTGG + Intergenic
967236008 3:187384271-187384293 CAAGGGATCCTGTGGGATGCTGG - Intergenic
967922388 3:194623009-194623031 CAGGGCGTCCTGAGGACGGCGGG - Intronic
968213317 3:196867740-196867762 CAGCGCGTTCTGAGGGAGGCCGG + Intergenic
968541592 4:1171005-1171027 CACCGTGTCCTGCGGGATGGTGG + Exonic
968728051 4:2257311-2257333 AAGAGTCCCCTGAGGGATGCTGG - Intronic
968969111 4:3784330-3784352 CAGGGAGCTCTGAGGGAAGCTGG - Intergenic
969515761 4:7647457-7647479 CACGGTGTCTTCAGGGATGAAGG - Intronic
970523561 4:16909405-16909427 CAGGGTGTCCGGAGGCATCCTGG - Intergenic
970598727 4:17623722-17623744 CAAGGAGCCCTGAGGGATGTCGG - Exonic
972863641 4:43203011-43203033 CAGGCTGTCTTGGGGGCTGCTGG + Intergenic
976343155 4:83967092-83967114 CAGGGTCTGCTGAGGCATGCAGG - Intergenic
978570032 4:110126858-110126880 CAAAGAGTCCTGAGGGATTCTGG - Intronic
984889064 4:184474976-184474998 CAGGGTGGCCTGAAGGTTCCAGG + Intergenic
985655830 5:1130955-1130977 GAGGGTGGTCTGAGGGCTGCTGG + Intergenic
986485268 5:8229705-8229727 CAGAGTGTCCTGAGCCAGGCTGG + Intergenic
986627132 5:9732547-9732569 CAGGGTGTCCTTAGGAATTCTGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
990749598 5:59000126-59000148 CAGGGTGGCCTCAGAGCTGCAGG - Intronic
992308109 5:75464434-75464456 CAGGGTGCTATGGGGGATGCGGG + Intronic
992616118 5:78547846-78547868 CAGGGTGGTCTGAGGGAGACTGG + Intronic
994957069 5:106545842-106545864 TAGGGTGTGCTGTGGGATGAAGG + Intergenic
995550473 5:113276177-113276199 CAGGGTGTCTGGAGGGAGTCAGG - Intronic
997528880 5:134570224-134570246 GACGCTGTCCTGAGGGAGGCAGG - Intronic
999184976 5:149700590-149700612 CAGGGAGTCCTGAGGGTTGGTGG - Intergenic
999192312 5:149757558-149757580 CAGCCTGTCCTGACGGATGAGGG + Intronic
1003472655 6:6451713-6451735 CTGCCTGTACTGAGGGATGCAGG - Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003603865 6:7542239-7542261 CCGGGTGTCCTGACGCGTGCGGG + Intronic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1007160971 6:39791908-39791930 CAGTGTGTCCCAAGGGGTGCTGG - Intergenic
1009194154 6:60664640-60664662 CATGGTGTCCCTAGGGAGGCTGG + Intergenic
1012487281 6:99736437-99736459 CAGGATGTACTGAGTGAGGCTGG - Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013655737 6:112244474-112244496 CAAGCAGTCCTGAGGGCTGCTGG - Intronic
1015237576 6:130988532-130988554 CAGGCTTTCCTGAGGGGTGGCGG + Intronic
1016321600 6:142852628-142852650 CAGGGTGTCCTGAGACATCTGGG - Intronic
1017949931 6:159128009-159128031 CAGGGTGTGCTCTCGGATGCTGG - Intergenic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1018545243 6:164928631-164928653 CAGAGCGTCCTGAGGTTTGCAGG - Intergenic
1018961603 6:168453187-168453209 CAGGGTGGCCTGACAAATGCGGG + Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019298341 7:290577-290599 CACGGCGTCCTGCGGGATGGGGG + Intergenic
1019466769 7:1193965-1193987 CAGGGTGTCCTGAGAGAGGTAGG - Intergenic
1019595593 7:1856960-1856982 CAGGGTTTCCTGGGGGGTCCAGG - Intronic
1023392798 7:39726567-39726589 CAGGCTGCCCTCAGGGTTGCAGG + Intergenic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1026568633 7:71510612-71510634 TAGGGAGACCTCAGGGATGCAGG + Intronic
1029202677 7:98849502-98849524 CAGAGGGTGCTGAGAGATGCAGG + Intronic
1029632887 7:101764213-101764235 CAGGCTGGCCTGACGGATGGAGG - Intergenic
1034676074 7:152893922-152893944 CAGGGTGCCCTGGGAGGTGCAGG - Intergenic
1036746629 8:11414525-11414547 CAGGGTGTCCTTAGGGCTGCAGG + Intronic
1038722962 8:30054509-30054531 GATGGTTTCCTGAGGGATGATGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1041219311 8:55633198-55633220 GAGGGTGTCATGAGGGACACAGG + Intergenic
1042254638 8:66790370-66790392 CAGGGTCTTCTGAGAGATACAGG + Intronic
1042975483 8:74464569-74464591 CAGGGTGTCTAGATGGACGCAGG - Intronic
1049220914 8:141428391-141428413 CAGGGGGTCCTGGGGGAGTCTGG + Intronic
1049618266 8:143585918-143585940 CAGGGTGTCCTGTGGGCACCTGG - Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049757117 8:144315643-144315665 CAAGGTGTCCTGAAGGCTGCAGG + Exonic
1051330640 9:16021977-16021999 CAGCCTCTCCTGATGGATGCAGG + Intronic
1052915370 9:33921194-33921216 GAGGGTGTCATGAGGTAGGCTGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056607521 9:88098734-88098756 CTGGGTGTCCTGAGGAAACCTGG - Intergenic
1057762494 9:97888153-97888175 CAGGGAGTATTGAAGGATGCAGG + Intergenic
1057946421 9:99333525-99333547 CTGGGGGTACTCAGGGATGCTGG + Intergenic
1058828592 9:108796065-108796087 CAGACTGTCCCCAGGGATGCTGG + Intergenic
1061995445 9:134180687-134180709 CAGGGATTCCTCATGGATGCGGG - Intergenic
1062005116 9:134235079-134235101 CAGGGTGTCCTGGGCCAGGCAGG + Intergenic
1185638318 X:1571383-1571405 CAGCTTGTCCTGTGGGCTGCTGG + Intergenic
1186434244 X:9529376-9529398 AAGGCAGTCCTGAGGGATGATGG + Intronic
1189242021 X:39532666-39532688 CAGGGAGGGCTGAAGGATGCAGG + Intergenic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1189925665 X:45951853-45951875 CAAGGAGCCCTGAGGGATGTCGG + Intergenic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1197893768 X:131289472-131289494 CAGGGAGTCCGGAGAGAGGCGGG - Intronic
1199502275 X:148520440-148520462 CAGAGTGTCCTGGGGGCTCCAGG + Intronic
1199809863 X:151338643-151338665 CAATGTGTCCTGAGGCTTGCTGG - Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1200860288 Y:7984009-7984031 CAAAGGGCCCTGAGGGATGCCGG - Intergenic
1202372682 Y:24209305-24209327 CAGGGTCTTCTGAGGGACCCAGG - Intergenic
1202498100 Y:25460815-25460837 CAGGGTCTTCTGAGGGACCCAGG + Intergenic