ID: 1132118670

View in Genome Browser
Species Human (GRCh38)
Location 15:99158071-99158093
Sequence CCTCATCAGCACCTGTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132118670_1132118673 5 Left 1132118670 15:99158071-99158093 CCACATTACAGGTGCTGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1132118673 15:99158099-99158121 ATAAATTTCTCAGGTGAAAGAGG 0: 1
1: 0
2: 1
3: 18
4: 261
1132118670_1132118674 19 Left 1132118670 15:99158071-99158093 CCACATTACAGGTGCTGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1132118674 15:99158113-99158135 TGAAAGAGGAATCTCTGTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 184
1132118670_1132118672 -4 Left 1132118670 15:99158071-99158093 CCACATTACAGGTGCTGATGAGG 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1132118672 15:99158090-99158112 GAGGCAGAAATAAATTTCTCAGG 0: 1
1: 2
2: 3
3: 38
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132118670 Original CRISPR CCTCATCAGCACCTGTAATG TGG (reversed) Intronic
900097952 1:947964-947986 CCTCATCAGCCCCTCCAAGGGGG + Intronic
900305937 1:2008063-2008085 ACTACTCAGCACCTGCAATGTGG - Intergenic
900673966 1:3872543-3872565 CCTCTTCAGCACCTGGAACCTGG + Exonic
900888886 1:5434989-5435011 CCTAATGCACACCTGTAATGTGG - Intergenic
904616294 1:31751996-31752018 CCACTTCATCACCTGTAAAGCGG - Intronic
905481764 1:38266659-38266681 CATCAGCAGCATCTGAAATGAGG - Intergenic
907514781 1:54986627-54986649 CATCATCAGCTTCTGTCATGGGG - Intronic
911055365 1:93704005-93704027 GCTATTCAGCACCTGAAATGTGG - Intronic
911532511 1:99061792-99061814 CATCATCAGAATCTGTACTGTGG - Intergenic
914925036 1:151877695-151877717 CCTAATGAGCACTTGAAATGTGG + Intronic
915103897 1:153520367-153520389 TGTCATCAGGACCTGTCATGAGG - Intergenic
919936544 1:202254565-202254587 GCACATCAGCACCTGGCATGGGG - Intronic
920714423 1:208326342-208326364 TCTCATCAGCACCTGTTTTGGGG - Intergenic
923144287 1:231186985-231187007 CCTCATCAGCAAGGCTAATGAGG + Intronic
1068006841 10:51401280-51401302 CAGCATCAGCACCTGATATGTGG - Intronic
1068188588 10:53619775-53619797 CCTCTTCAGCTCCTGTATTGTGG - Intergenic
1069001294 10:63269286-63269308 CTCCATCAGCACCTGTGACGGGG - Intronic
1075649740 10:124119627-124119649 CCTCATCATCATCTCTAAAGTGG + Intergenic
1081216660 11:40407541-40407563 CCTCATCTTCTCCTGGAATGAGG + Intronic
1083815856 11:65132151-65132173 CTTCCTCAGCACCTGCTATGTGG - Intronic
1083967444 11:66051419-66051441 CCTCAGCCGCACCTGCACTGGGG - Intronic
1085403864 11:76250221-76250243 CCTTCTCATCACCTGCAATGTGG + Intergenic
1086141961 11:83509325-83509347 TATCATCACCACTTGTAATGAGG + Intronic
1087551109 11:99650279-99650301 CCTCATCAGCAAATCTAATGGGG + Intronic
1090838870 11:130472829-130472851 CCACATCCTCACCTGTAAAGTGG - Intronic
1091653598 12:2327785-2327807 CTTCATGAGTACCTATAATGAGG - Intronic
1095153046 12:38818294-38818316 ACACACCAGCACCTGTCATGGGG - Intronic
1097355512 12:58596458-58596480 CTTCATGAATACCTGTAATGGGG - Intronic
1097595164 12:61620483-61620505 ACCCATCAGCACCAGGAATGAGG + Intergenic
1097995592 12:65884304-65884326 CCTCTTCAGCATCTCTAATCTGG - Intronic
1098089640 12:66887401-66887423 CCTCATAACAACCTGTAAAGTGG - Intergenic
1098280382 12:68856394-68856416 CCACATCACCACCTGGAATCAGG - Exonic
1101370483 12:104124739-104124761 GCTCAGGAGCACCTGAAATGTGG - Intronic
1103942980 12:124510903-124510925 CCTCATCAGAACCCGGAATCTGG + Intronic
1111304054 13:86383011-86383033 TCTCCTCATCACCCGTAATGTGG - Intergenic
1113414536 13:110117958-110117980 CCTTCTCAGCACCTGTGATTAGG + Intergenic
1118319936 14:64747168-64747190 CCAAATCAGCACCTGAAGTGAGG - Exonic
1120191965 14:81447725-81447747 CCTCATAAGAACCTATAAGGTGG - Intergenic
1122416018 14:101549825-101549847 CCTCATGACCACCTGCAGTGGGG - Intergenic
1122545152 14:102517700-102517722 CAGCATCTGCACCTGTAAAGTGG - Intergenic
1123581609 15:21719552-21719574 CCTCAACAGCATCATTAATGTGG - Intergenic
1123618258 15:22162175-22162197 CCTCAACAGCATCATTAATGTGG - Intergenic
1127608257 15:60611949-60611971 AAACATCAGCACCTTTAATGTGG - Intronic
1128113608 15:65092048-65092070 CCTCATCTGAATGTGTAATGGGG - Intergenic
1130215717 15:81967075-81967097 CCTCATCATCCCAAGTAATGGGG - Intergenic
1131217524 15:90551475-90551497 CCTCCTGAGCACTTGAAATGTGG - Intronic
1132118670 15:99158071-99158093 CCTCATCAGCACCTGTAATGTGG - Intronic
1134977566 16:18583016-18583038 CCTCAGTAGCACCTGACATGTGG + Intergenic
1135357473 16:21781496-21781518 CCAGGTCAGCACCTGCAATGAGG + Intergenic
1135455977 16:22597612-22597634 CCAGGTCAGCACCTGCAATGAGG + Intergenic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1141618848 16:85225880-85225902 CCTCATCAGCACGTCAACTGGGG + Intergenic
1142915554 17:3133683-3133705 TTTCATCAGCACCTGGAATTAGG + Intergenic
1144074271 17:11702762-11702784 ACTCCTCAGCCCCTGCAATGTGG - Intronic
1144691743 17:17270923-17270945 CTTCATCAGCACTTGTAATGGGG - Exonic
1148151333 17:45397975-45397997 CATCATCAGCACCTGGCATAAGG - Exonic
1153120400 18:1717782-1717804 ACTCACCAGCACCTGGAATCTGG + Intergenic
1153704184 18:7728423-7728445 CCTCTTCAGCTCCTGTATGGTGG - Intronic
1154177637 18:12095001-12095023 CCTCAGCAGCACCTGGGATGTGG + Intronic
1155030259 18:21978107-21978129 GCTCATGAGCACTTGAAATGAGG - Intergenic
1161066390 19:2240435-2240457 CCTCCTCAGCAGCTGAAATGGGG - Intronic
1161548443 19:4896659-4896681 CCCCATCGGTACCTGGAATGGGG + Exonic
1161645803 19:5452671-5452693 CAGCATCAGCACCTGCACTGCGG - Intergenic
1162799814 19:13104268-13104290 CTTCATCCCCATCTGTAATGAGG - Intergenic
1163159664 19:15457189-15457211 CCTGAGTTGCACCTGTAATGGGG - Intronic
1164465845 19:28486938-28486960 CCTCATGAGAACCTGGAATCAGG - Intergenic
1166850076 19:45755745-45755767 CCCTATCAGAAGCTGTAATGGGG - Intronic
1166928551 19:46286661-46286683 GCTACTGAGCACCTGTAATGTGG - Intergenic
925046343 2:775395-775417 CCAAATCAGCACCTGGAATAAGG + Intergenic
927220685 2:20705995-20706017 CCTCTTGAACACCTGAAATGTGG + Intronic
928544592 2:32317652-32317674 TCTCATGAGCACTTGAAATGTGG + Intergenic
932430556 2:71671533-71671555 CCACATCTCCACCTGTCATGAGG - Intronic
933389527 2:81652557-81652579 CCTCATCAACAGCTGGAAAGAGG - Intergenic
933671364 2:85010569-85010591 CCACATGAGCACTTGAAATGTGG + Intronic
935445710 2:103154292-103154314 TCTCATCAGCAATTGGAATGTGG - Intergenic
936934638 2:117827293-117827315 CCTGATGAGCACCTGTGCTGTGG - Intronic
937039395 2:118809161-118809183 CCTCTACGGCACCGGTAATGAGG - Intergenic
937983099 2:127626405-127626427 CCTCATTAGCATCTGTAGGGCGG - Intronic
939317852 2:140576094-140576116 CGTCTTCAGCACCTGAAGTGTGG - Intronic
941887349 2:170541861-170541883 CCACATCAGTACCTGGAAGGAGG - Intronic
943403110 2:187441540-187441562 CCTCATAAGTACCTCTTATGAGG + Intronic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
949072384 2:242033410-242033432 CCTCATCTGCACATGACATGGGG - Intergenic
1169794035 20:9442231-9442253 GCTCTTGAGCACCTGAAATGTGG - Intronic
1169800054 20:9505654-9505676 CCTCTTCATCACCTGTCAAGTGG - Intergenic
1171230409 20:23479783-23479805 CCTAAACATCACCTGTAATGTGG + Intergenic
1173617654 20:44413557-44413579 CCACATCAGCATGTGGAATGAGG - Intronic
1175240882 20:57547718-57547740 CCTCATCACCACCTGGCAAGGGG - Intergenic
1175644961 20:60663323-60663345 CATCATTAGCAACTGTAATGTGG + Intergenic
1181918273 22:26298427-26298449 CCCCACCACCACCTGTAAGGTGG + Intronic
1182549165 22:31091706-31091728 CCTACTCAGCACCAGTAGTGGGG + Exonic
1182704429 22:32267750-32267772 GCTCTTGAGCACCTGAAATGGGG - Intergenic
1182910864 22:33983129-33983151 CCTCTTCAGCTCTTGAAATGTGG - Intergenic
1183771367 22:39928797-39928819 TCCCATCAGCATCTATAATGAGG - Intronic
1183805226 22:40203745-40203767 TCTCAGCAGCACCTGCCATGTGG - Intronic
1183814729 22:40290177-40290199 CCACATCAGCCCTTGAAATGTGG + Intronic
1184116636 22:42426334-42426356 CCACCTCAGCACCTGCAATGGGG + Intronic
949791812 3:7801114-7801136 CTTCACCATCACCTGCAATGGGG + Intergenic
950521916 3:13502395-13502417 CCTCCTCAGGACCCCTAATGAGG + Intronic
951519046 3:23594242-23594264 CCCCATGAGCACTGGTAATGTGG + Intergenic
952803967 3:37328451-37328473 CCTCATCAGCTGTTTTAATGTGG - Exonic
955469861 3:59275096-59275118 CATCATTAGCATCTGAAATGAGG - Intergenic
958536198 3:95407854-95407876 CCTCATCAGCTCCTGTGTGGTGG + Intergenic
960750503 3:120946602-120946624 CCTCAAAACCACCTGTGATGGGG - Intronic
962360538 3:134738982-134739004 CCTCATCGGCACTTGTTATCTGG - Intronic
962858670 3:139375494-139375516 GGTCATCTGCACCTGAAATGAGG + Exonic
963961380 3:151313097-151313119 CCTCATTAACACCACTAATGAGG + Intronic
964170661 3:153766547-153766569 CCACACCAGGACCTGTCATGGGG + Intergenic
964315097 3:155435090-155435112 CTTCATCAGCATCTGAAAAGTGG - Intronic
966757113 3:183381791-183381813 CCTCATCAGTCACTGTAATGAGG - Intronic
967893608 3:194380687-194380709 CCTCTTCATCACCTGTCATCAGG - Intergenic
968132123 3:196198025-196198047 GCCCATCAGCACATGTAGTGGGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
974192551 4:58525471-58525493 CTTAATGAGCACCTGTGATGTGG - Intergenic
983852949 4:172605919-172605941 CCTCTTCAGCTCCTGTATGGTGG - Intronic
984436358 4:179715176-179715198 GCTCCTCAGCAACTGAAATGTGG - Intergenic
985075898 4:186214242-186214264 CCTCAGCATCACCTGCCATGTGG - Intronic
985508432 5:298521-298543 CCTCATCTGCACATGACATGGGG - Intronic
985567192 5:625055-625077 CCTCACCAGCACCAGCCATGGGG - Intronic
985581406 5:697253-697275 CCTCATCAGCCCCTGACCTGTGG - Intergenic
985596034 5:788578-788600 CCTCATCAGCACCTGACCAGTGG - Intergenic
985739615 5:1607147-1607169 CCTCATCTGCACATGACATGGGG + Intergenic
985898476 5:2765174-2765196 CCACATCAGCACCTGCACTCTGG + Intergenic
985950192 5:3217169-3217191 CCTCCTCAGGATCTGTGATGAGG - Intergenic
988967476 5:36433750-36433772 AGTCATCATCACCTGTCATGTGG + Intergenic
990228085 5:53679425-53679447 CATCAACAGCAACTGTAATCTGG + Intronic
995255170 5:110037632-110037654 CCTCATGAGCATCTGTTTTGGGG - Intergenic
997351778 5:133236210-133236232 CCTCATCACCACCTGTGTGGTGG + Intronic
997843347 5:137262663-137262685 CCTCTTCAGCTCCAATAATGGGG + Intronic
998591408 5:143482795-143482817 GCTCATAAGCACTTGAAATGTGG - Intergenic
998861709 5:146450612-146450634 CCTCACCAGAACCTGCAATGAGG - Intronic
998894199 5:146781000-146781022 CATCATCATCATCTGAAATGTGG - Intronic
999861623 5:155653747-155653769 CCTCACCAGCATCTGTTGTGTGG + Intergenic
1009241649 6:61192991-61193013 CCTTCTCATCACCTGTAATGTGG + Intergenic
1010846961 6:80720707-80720729 CCTCCTCATCACCTGCAATGTGG - Intergenic
1017858888 6:158376771-158376793 CCACATCTGCTCCTGTTATGTGG - Intronic
1021679422 7:23115083-23115105 CTTCTTCAGCAGCTGCAATGTGG + Intronic
1021727410 7:23562258-23562280 CCTCATCAGGAACAGTAAAGTGG + Intergenic
1021900073 7:25276427-25276449 CCGCTTCAGCACCTTTGATGTGG + Intergenic
1022138828 7:27474689-27474711 GCTCAACAGCACATGTAATGGGG + Intergenic
1024136335 7:46412655-46412677 CCTCAGCAGCATCTGGAGTGGGG + Intergenic
1026946205 7:74317785-74317807 TGTCATGAGCTCCTGTAATGGGG + Intronic
1028017670 7:85735915-85735937 CCCCAGCACCACCTGGAATGTGG + Intergenic
1028420455 7:90627160-90627182 GCTAATGAGCACCTGAAATGTGG - Intronic
1031993367 7:128212015-128212037 CCACATCAGCATCTGTGTTGAGG + Intergenic
1032255222 7:130291769-130291791 CCTCATCCCCACCTTTGATGGGG + Intergenic
1035594533 8:845292-845314 CCTCACCAGCACTTGTTATTTGG + Intergenic
1035951025 8:4021147-4021169 GCTCATGAGCACGTGAAATGTGG + Intronic
1039553734 8:38461729-38461751 CCTCATAATCACCTGTGATGTGG - Intronic
1042643516 8:70960541-70960563 CCTTATCAGCAACTGCAGTGGGG - Intergenic
1042647725 8:71005827-71005849 CCACCTCAGCAGCTGTAAGGAGG - Intergenic
1044129456 8:88503664-88503686 CCTCATCACTATTTGTAATGAGG - Intergenic
1046190857 8:110792279-110792301 CCTCATGTGCTCCTTTAATGTGG + Intergenic
1047303369 8:123634059-123634081 TCTCATCATCACCTCTAGTGAGG + Intergenic
1047545003 8:125807355-125807377 CATCCACAGCATCTGTAATGAGG - Intergenic
1050084240 9:1947881-1947903 CCCCATCATCATCTGTGATGAGG + Intergenic
1051538450 9:18187080-18187102 TTTCATCAGCAACTGTCATGTGG + Intergenic
1052261935 9:26526874-26526896 CAACATCAGCACCTGTGCTGAGG + Intergenic
1052528155 9:29648026-29648048 CCTGGTCAGGACCTGTAATTAGG + Intergenic
1053198763 9:36138776-36138798 CTTCACCAGCACCTGTCTTGTGG - Intronic
1053562591 9:39211202-39211224 CCTCATCACCACCTGGGATGGGG + Intronic
1053825847 9:42023421-42023443 CGTCACCAGCACCTTTACTGGGG - Intronic
1053828397 9:42049194-42049216 CCTCATCACCACCTGGGATGGGG + Intronic
1054134559 9:61407837-61407859 CCTCATCACCACCTGGGATGGGG - Intergenic
1054450922 9:65403303-65403325 TTTCTTCAGCACCTGTCATGGGG - Intergenic
1054602162 9:67138260-67138282 CCTCATCACCACCTGGGATGGGG - Intergenic
1054604716 9:67163972-67163994 CGTCACCAGCACCTTTACTGGGG + Intergenic
1055690053 9:78820357-78820379 CCTCATTAGAACCTCTAAGGAGG + Intergenic
1055967554 9:81880459-81880481 CATAAACAGCAACTGTAATGCGG + Intergenic
1056977674 9:91274374-91274396 CCTCATCAGCACTAGCAAAGAGG + Intronic
1057277696 9:93684759-93684781 CCACATCAGCACCAGAAGTGGGG - Intergenic
1058835782 9:108857542-108857564 CCTCATGGGCTCCTGTGATGTGG + Intergenic
1060940705 9:127541566-127541588 CCTGCTCAGGACCTGTAATCAGG + Intronic
1062017072 9:134296375-134296397 CCTCAAAACCACCTGTTATGGGG - Intergenic
1187975061 X:24696607-24696629 CCTTTTCAGCTTCTGTAATGGGG + Intronic
1190591222 X:52003731-52003753 CCCCATCAGCTCCTGGAATCAGG + Intergenic
1195296509 X:103483753-103483775 CCTCAGCATCATCTGTAAGGAGG + Intergenic
1195715458 X:107813826-107813848 CATCATCAGCCCCTAAAATGTGG - Intergenic
1195727544 X:107933996-107934018 CCTCATCAGAACCTGGGAGGTGG + Intergenic
1198189548 X:134288512-134288534 CCTTCTCATCACCTGCAATGTGG - Intergenic
1199136206 X:144255721-144255743 CCTCCTAAGGACCTGTAATCAGG + Intergenic
1200687686 Y:6271937-6271959 CCTCATCCTCACCAGAAATGAGG + Intergenic
1201047584 Y:9902766-9902788 CCTCATCCTCACCAGAAATGAGG - Intergenic