ID: 1132122208

View in Genome Browser
Species Human (GRCh38)
Location 15:99185797-99185819
Sequence ACGGCTCTTTCAGCAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132122203_1132122208 9 Left 1132122203 15:99185765-99185787 CCCCTGCGGCAGAGGGAGGGATG 0: 1
1: 1
2: 4
3: 30
4: 256
Right 1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1132122205_1132122208 7 Left 1132122205 15:99185767-99185789 CCTGCGGCAGAGGGAGGGATGAG 0: 1
1: 0
2: 2
3: 43
4: 397
Right 1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1132122204_1132122208 8 Left 1132122204 15:99185766-99185788 CCCTGCGGCAGAGGGAGGGATGA 0: 1
1: 0
2: 3
3: 21
4: 206
Right 1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1132122200_1132122208 14 Left 1132122200 15:99185760-99185782 CCGGACCCCTGCGGCAGAGGGAG 0: 1
1: 0
2: 1
3: 19
4: 272
Right 1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132122208 Original CRISPR ACGGCTCTTTCAGCAGTCCC TGG Intronic
900181777 1:1314263-1314285 ACGGCTCTTTAAGGAGCCCCTGG - Intronic
901396817 1:8987821-8987843 ACGATTCTTTCTGCTGTCCCTGG - Intergenic
903207664 1:21795068-21795090 ACGCCTCCTGCAGCAGGCCCGGG - Intergenic
906281873 1:44559991-44560013 ACGGCTCCTTCAGCACCTCCCGG + Intronic
907525571 1:55052170-55052192 AAGGCGCTTTCACCAGTGCCTGG + Intronic
909857084 1:80548782-80548804 ATGTGTCTTTCAGCATTCCCAGG - Intergenic
912674612 1:111667106-111667128 GAGGCTATTTCAGTAGTCCCAGG + Intronic
915737105 1:158091888-158091910 ACAGCTCTTTCTGCAGCCCCTGG - Intronic
1064600816 10:16990466-16990488 CAGGCTCCTTCAGCAGCCCCGGG - Exonic
1066233094 10:33456983-33457005 TTGGCTCGTTCACCAGTCCCAGG + Intergenic
1067561674 10:47308927-47308949 ACAGCCATGTCAGCAGTCCCAGG - Intronic
1067563624 10:47321492-47321514 ACTGCTCTTAACGCAGTCCCTGG + Intergenic
1068910418 10:62374014-62374036 GCGGCGCTTTCTGCAGGCCCTGG - Intergenic
1074458808 10:113618612-113618634 GTGGCTCTTTCAACAGTGCCGGG + Intronic
1074509331 10:114098727-114098749 AGGGCTGTTTCAGCTTTCCCTGG - Intergenic
1081397107 11:42599327-42599349 ACGGCTATGTCAGGAGTGCCTGG - Intergenic
1081432936 11:42996510-42996532 CTGGCTCTTTCATCAATCCCAGG + Intergenic
1081743852 11:45459414-45459436 CCGGCTCTTGCAGGAGACCCTGG - Intergenic
1085620131 11:78031747-78031769 ACTGCTCTTTCCCCAGTGCCTGG - Intronic
1089768960 11:120788909-120788931 AGGGCTCTTGCTGAAGTCCCCGG + Intronic
1090262218 11:125329978-125330000 ACGGCTGTGTCGGCAGTGCCTGG + Intronic
1100803643 12:98258967-98258989 AGGCCTCTTTCAACAGACCCAGG - Intergenic
1106356708 13:28990194-28990216 ACAGCTCCTTCCGAAGTCCCAGG - Intronic
1106849882 13:33778783-33778805 ACCTCTCTTCCATCAGTCCCTGG - Intergenic
1119849968 14:77860309-77860331 TTGGCTCTTTAAGCAGACCCAGG - Intronic
1123881837 15:24684021-24684043 ATGGCTCTCTCAGAAGTCCCAGG + Intergenic
1124521323 15:30408410-30408432 GCTGCGCTTTCAGCAGTGCCTGG + Exonic
1124537339 15:30557807-30557829 GCTGCGCTTTCAGCAGTGCCTGG - Exonic
1124761316 15:32449780-32449802 GCTGCGCTTTCAGCAGTGCCTGG + Exonic
1124777318 15:32599283-32599305 GCTGCGCTTTCAGCAGTGCCTGG - Exonic
1125604515 15:40932379-40932401 ACGGCACCTGCAGCACTCCCTGG + Exonic
1127233485 15:57021881-57021903 AGGGGTCTTTAATCAGTCCCCGG + Intronic
1127799083 15:62462390-62462412 ACGGGCCTTTCAGAAGACCCAGG - Intronic
1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG + Intronic
1132858982 16:2060792-2060814 ACGGCTCCTTCAGCAGCTCCAGG + Exonic
1133337679 16:5016583-5016605 ATGGCTCTGTCAGCAGTGGCTGG + Exonic
1134067232 16:11236654-11236676 ATGGCACTTCCAGCAGTGCCTGG + Intergenic
1139283090 16:65786415-65786437 AGGGCTCTTTCGGCAGGCTCTGG - Intergenic
1141445966 16:84058513-84058535 ACAGCTCTGACAGCTGTCCCTGG + Intronic
1146974480 17:37099152-37099174 ACGGCTCAGTCAGCAGCCCAAGG - Intronic
1147039989 17:37711157-37711179 ACGGCTCTTTCAAGGGTCACTGG - Intronic
1150710759 17:67529118-67529140 CCGGCTCATTCAGCAGCCACTGG + Intronic
1152893003 17:82893043-82893065 AGGCCTCACTCAGCAGTCCCGGG - Intronic
1153694937 18:7630396-7630418 ACGGCTCTTGCTGAAGTCACAGG - Intronic
1155819962 18:30362427-30362449 ACGCCTCCTGCAGCAGGCCCAGG + Intergenic
1156954963 18:42951412-42951434 CCTCCTCTTTTAGCAGTCCCCGG - Intronic
1158730492 18:60017495-60017517 GCGTCTCTCTCAGCAGTCACCGG - Intergenic
1159902640 18:74061932-74061954 AGGTCTCTTTCAGCTGTCCATGG + Intergenic
1163272132 19:16260695-16260717 AGGTCTCTGTCAGCAGTCCCAGG - Intergenic
1163860008 19:19737931-19737953 AGGGCTCTTCCAGCAGAGCCTGG - Intergenic
1168289930 19:55352676-55352698 ACGGCTCCCTCAGCAGGACCAGG + Exonic
925480031 2:4260235-4260257 ACGGCTCTGTCAGCATGACCTGG + Intergenic
927883976 2:26707252-26707274 ACGGCTCCCACAGTAGTCCCTGG + Intronic
933154995 2:78963524-78963546 ACTGCTCTCTCATCAGTACCAGG - Intergenic
947145378 2:227059449-227059471 AGGGGTCTTTCAGGAGTGCCAGG - Exonic
948392619 2:237624001-237624023 ACGGGTCCTTCAGCATTCCTGGG + Intergenic
1170036572 20:11996069-11996091 ACAGCTTTTCCAACAGTCCCAGG + Intergenic
955733767 3:62015296-62015318 CCTGCTGTTTCAGCAGCCCCGGG - Intronic
959895484 3:111600845-111600867 ATGGCTCTGTCTCCAGTCCCAGG + Exonic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
967403824 3:189094480-189094502 ATGGCTCTTTAAGAGGTCCCAGG + Intronic
969719284 4:8884357-8884379 ATCGCACTTTCTGCAGTCCCTGG - Intergenic
969969560 4:11031858-11031880 AAGGCTCCTTGATCAGTCCCTGG - Intergenic
972705566 4:41539298-41539320 GTGGCTGATTCAGCAGTCCCGGG + Intronic
981462331 4:145028060-145028082 ACAGCTCTTTCAGCTTCCCCTGG - Intronic
982003252 4:151040552-151040574 ACAGCTCTATCATCAGTGCCTGG - Intergenic
982233100 4:153227210-153227232 AAGGCTCTTTCAGCATTACCTGG + Intronic
999426356 5:151490712-151490734 GTGGCTCTTTCAGAAGACCCAGG + Exonic
1002890231 6:1325660-1325682 AAGGCTCTTTCATGAGTCACAGG + Intergenic
1006979221 6:38133274-38133296 TCGGCTCTTACTGCAGTGCCTGG + Intronic
1007227198 6:40323406-40323428 AAAGCTCTTTCAGCAGCACCTGG - Intergenic
1016004968 6:139079871-139079893 ACGGCTCTAGTAGCAGTCTCAGG - Intergenic
1018354747 6:163001015-163001037 AGGGCTCTTTCGGCCTTCCCGGG - Intronic
1018659639 6:166074033-166074055 ACGGCTCCTCCACCTGTCCCTGG - Intergenic
1018835439 6:167480014-167480036 TCTGCTCTTTCAGCATTCACAGG - Intergenic
1021655435 7:22869542-22869564 ACGGCCCTTTCAGCTCTCTCTGG - Intergenic
1023205015 7:37739650-37739672 GCGGATCTTTCAGGAGTCCAGGG + Intronic
1028088472 7:86667905-86667927 AAGGCTCTTTAAGCAGACACCGG + Intronic
1035376711 7:158411392-158411414 ACAGCTCCTTCAGCAGCCTCTGG + Intronic
1035390568 7:158501570-158501592 ACAGCTCTGTCAGCAGTCGCAGG + Intronic
1042241166 8:66666208-66666230 ACAGCACTTTCAGCAGCACCTGG - Exonic
1047724290 8:127670748-127670770 AGGGCTCTTACAGTTGTCCCAGG + Intergenic
1048778895 8:137979550-137979572 ATTGTTCTTTCAGCAGTCACTGG - Intergenic
1049847541 8:144810389-144810411 ATGGCTCTTTCTGCAGCCCCTGG - Intronic
1052028508 9:23601934-23601956 ACAGATCTTTCAGCAGTCATTGG + Intergenic
1057439270 9:95070857-95070879 ACAGCTCATCCAGCAGACCCAGG - Intronic
1057450136 9:95151074-95151096 GTGGCGCTTTCTGCAGTCCCAGG - Intronic
1059327994 9:113516252-113516274 ACAGCTCTGTCAGCAGGGCCTGG + Intronic
1060827314 9:126694580-126694602 CCGCCTGCTTCAGCAGTCCCAGG - Intronic
1061098303 9:128472876-128472898 ACGGCTCTGTGAGCCCTCCCAGG - Intronic
1189250886 X:39600041-39600063 AGGGCTAGTTCAGCATTCCCAGG - Intergenic
1192632874 X:72790665-72790687 ACCTCTCTTCCAGCAGGCCCAGG + Intronic
1192648835 X:72930136-72930158 ACCTCTCTTCCAGCAGGCCCAGG - Intronic
1194383027 X:93219052-93219074 ACGGCTTTATCAGCAGCCCTTGG + Intergenic
1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG + Intergenic
1199676277 X:150191941-150191963 TCTGCTCTTTCCCCAGTCCCTGG - Intergenic
1202275221 Y:23111159-23111181 ACGGATCTGGCATCAGTCCCTGG - Intergenic
1202290807 Y:23309532-23309554 ACGGATCTGGCATCAGTCCCTGG + Intergenic
1202428212 Y:24744878-24744900 ACGGATCTGGCATCAGTCCCTGG - Intergenic
1202442579 Y:24925211-24925233 ACGGATCTGGCATCAGTCCCTGG + Intergenic