ID: 1132123387

View in Genome Browser
Species Human (GRCh38)
Location 15:99197513-99197535
Sequence CATATTTAGCACTATGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132123387 Original CRISPR CATATTTAGCACTATGTATC AGG Intronic
904334591 1:29788358-29788380 TTTATTGAGCACTATGTACCAGG + Intergenic
906837690 1:49101525-49101547 CTTATTTAGAACCATGTATTAGG - Intronic
908044281 1:60151536-60151558 CACATTTACCACTAAGTAGCTGG + Intergenic
908219705 1:61992772-61992794 AAAATTCAGCACTATGTATGTGG + Intronic
909580415 1:77227296-77227318 TTTATTAAGCACTATGTACCAGG + Intergenic
909868595 1:80707749-80707771 CATAATTAGCTCTACGTATTAGG + Intergenic
911358736 1:96851197-96851219 CATATTCAGCAATATGTATTGGG + Intergenic
911362047 1:96889075-96889097 CATATTCAGGATTATTTATCAGG - Intergenic
912913595 1:113788987-113789009 GATATTGTGCAATATGTATCTGG + Intronic
913364889 1:118026422-118026444 CATTTTAAGAACTATATATCAGG + Intronic
915293225 1:154900478-154900500 CATAATTAGAACCATGTATTGGG + Intergenic
918391438 1:184067470-184067492 CTTACTTAGCACCATGTACCAGG - Intronic
918805938 1:189044673-189044695 AATAGTTAGAACTATGTATCAGG + Intergenic
918970737 1:191414905-191414927 CATATCAAGCACTATGTTTGGGG - Intergenic
921086538 1:211799046-211799068 CTTATTTAGAAGTATGTATTAGG - Intronic
921226433 1:213024806-213024828 CATATTTAGAACTATGTAGATGG + Intergenic
1063650212 10:7928278-7928300 CCTATGTGGCACTAGGTATCAGG - Intronic
1063684620 10:8224956-8224978 CCTATTTATCACTATCCATCAGG + Intergenic
1065113986 10:22466308-22466330 AATATATAGCATTATGTAGCAGG + Intergenic
1067968635 10:50943367-50943389 CATATAAAGCACTTTGTTTCTGG + Intergenic
1068551106 10:58408926-58408948 CATAGTAAGCACTAAATATCAGG + Intergenic
1069560519 10:69426171-69426193 CTTATTTAGCCCTTTGTGTCAGG - Intergenic
1069846019 10:71372220-71372242 CTTATTGAGCACTATGAACCGGG + Intergenic
1073514410 10:104064215-104064237 AATATATAGCACGGTGTATCAGG - Intronic
1078904733 11:15673263-15673285 TATATTGAGAACTATGTATTAGG + Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1082862924 11:57872605-57872627 CATATTTAGAATTGTGTAACAGG + Intergenic
1083073629 11:60014045-60014067 CATATTTACCACTCTGTTTGGGG - Intergenic
1083835037 11:65261109-65261131 ACAATTTAGCAATATGTATCAGG - Intergenic
1084344527 11:68536567-68536589 CATTTTTAGAAGTATGTATTTGG - Intronic
1084346181 11:68550692-68550714 AATATTTAGCACCAAGTCTCTGG - Intronic
1085168113 11:74423098-74423120 CATATTTATTATAATGTATCAGG + Intergenic
1086435918 11:86781214-86781236 CTTATATAGCACTATGTAACAGG + Intergenic
1087819596 11:102696956-102696978 CATATGTACCACCATTTATCTGG + Intronic
1089339214 11:117746249-117746271 CTTATATAGCACTATGTGCCAGG - Intronic
1090309651 11:125723903-125723925 CATATCTAGCACCATTTATGTGG - Intergenic
1091076884 11:132627417-132627439 TATATATAGCACAATCTATCAGG + Intronic
1093724286 12:22485636-22485658 CATACTAAGCACTAAGTAGCAGG + Intronic
1094055821 12:26268811-26268833 CATACCTTGCTCTATGTATCTGG - Intronic
1095448667 12:42306600-42306622 CATATTTAGCACTATGTTTCAGG - Intronic
1095909698 12:47413871-47413893 CTTATTAAGCACTATGTACCAGG + Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1098277176 12:68824814-68824836 CTTATTTAGCAATATTTTTCTGG + Intronic
1098391571 12:69975003-69975025 CATATTTAGAACTATGGAGCTGG - Intergenic
1100873766 12:98940680-98940702 TTTATTTAGCACTTTGTCTCAGG - Intronic
1101677246 12:106928389-106928411 CATTCTTCGCACTATGTACCAGG - Intergenic
1102799472 12:115718914-115718936 TATATTCAGCACTAAGTTTCAGG - Intergenic
1103449027 12:121015027-121015049 CATATTTGCCACCATGTATTGGG + Intronic
1106394710 13:29368599-29368621 CATATTTATACCTATGTATGGGG - Intronic
1107179661 13:37444112-37444134 CAAATTTACCACTATGGACCAGG - Intergenic
1109621354 13:64911008-64911030 CATATTGAGCAGTATATTTCTGG + Intergenic
1114990568 14:28282372-28282394 CTTATGTAGTACTATGTATCTGG - Intergenic
1115427595 14:33278299-33278321 CAGAGTTATCAGTATGTATCTGG + Intronic
1116359150 14:43971153-43971175 CATATTTACAACTAGGAATCTGG - Intergenic
1116706514 14:48309108-48309130 TATTTTTTGCAATATGTATCTGG - Intergenic
1116768845 14:49103999-49104021 GCTATTTAGCACTATGTACTAGG - Intergenic
1117118287 14:52539546-52539568 CATATGTAGCCAGATGTATCAGG - Intronic
1120258858 14:82156861-82156883 CACCATTAGCACTATGTCTCTGG - Intergenic
1120316937 14:82906241-82906263 AATTTTTATCATTATGTATCTGG - Intergenic
1125378913 15:39065254-39065276 AATATTTAGCACTTGGAATCTGG + Intergenic
1125386788 15:39145808-39145830 CATATTTATCATTATGCAGCAGG - Intergenic
1131696838 15:94886368-94886390 TATATCTAGCCCAATGTATCTGG + Intergenic
1131862733 15:96671495-96671517 CATGTTTAGCAGTAAGTAGCGGG + Intergenic
1132123387 15:99197513-99197535 CATATTTAGCACTATGTATCAGG + Intronic
1134518357 16:14905219-14905241 CATTCTCAGCACTCTGTATCAGG - Intronic
1134555572 16:15161004-15161026 CATTCTCAGCACTCTGTATCAGG + Intergenic
1134706028 16:16303872-16303894 CATTCTCAGCACTCTGTATCAGG - Intergenic
1134961512 16:18408238-18408260 CATTCTCAGCACTCTGTATCAGG + Intergenic
1134965812 16:18490841-18490863 CATTCTCAGCACTCTGTATCAGG + Intronic
1135142562 16:19934230-19934252 TGTATTTAGCACGATGTGTCTGG + Intergenic
1135887256 16:26321520-26321542 CCTATTTAGCACTTTCTAACTGG + Intergenic
1135943954 16:26847559-26847581 CTTATGTGACACTATGTATCAGG + Intergenic
1138503173 16:57461381-57461403 TATAATTACCACTATGTATTAGG - Intergenic
1139024710 16:62801229-62801251 GATATGTAGCCCTATGTATATGG + Intergenic
1140628725 16:76826426-76826448 AATATTGACCACTATGTACCAGG + Intergenic
1140771384 16:78207380-78207402 AATATTTGGCAATATCTATCAGG - Intronic
1145742760 17:27289938-27289960 CATATATAGTACTCTGTGTCAGG + Intergenic
1149417220 17:56471781-56471803 AACATTTAGCACTTTGTGTCTGG - Intronic
1150027665 17:61694341-61694363 AATATGTAGCATTTTGTATCTGG + Intronic
1154392776 18:13955262-13955284 CATATTTAGCACTTTGTTAAGGG - Intergenic
1158246245 18:55435515-55435537 CATACTCAGCACTATGTGTCAGG - Intronic
1160548275 18:79676511-79676533 CATGTTTAGGACTATGAATTTGG - Intergenic
1164271798 19:23679322-23679344 ACTATTTAGCACTATGTACAAGG + Intronic
1166606767 19:44150230-44150252 CATATTTATGTCTATGTGTCTGG + Intronic
926492539 2:13542581-13542603 CATGGTTAACAGTATGTATCTGG + Intergenic
927266718 2:21160881-21160903 CATATTTATCACCAAGTTTCTGG + Intergenic
931178136 2:59873853-59873875 CATATTGTGCACTCTGTATTAGG + Intergenic
935037638 2:99394467-99394489 CATGTTTATCTGTATGTATCAGG - Intronic
935847201 2:107178765-107178787 GATATTTAGCATTCTGTATCCGG + Intergenic
938034153 2:128022205-128022227 CATCTGTAGTCCTATGTATCTGG + Intronic
941043083 2:160645096-160645118 CCTATTTAGCATTATCTATGTGG - Intergenic
941630783 2:167882119-167882141 CATATTTAGTCCTATATATTTGG + Intergenic
942594424 2:177579495-177579517 CCTATTCTGCACTATGTACCTGG + Intergenic
943507628 2:188781629-188781651 CATACTTAGCACTAAGTAAGTGG + Intronic
944246826 2:197539164-197539186 AATATTTAGTTCAATGTATCAGG - Intronic
944545264 2:200792983-200793005 TATATTGAGTACTATGTGTCAGG - Intergenic
1169687051 20:8287317-8287339 TATATTTAGCACAGTGTTTCTGG + Intronic
1172270432 20:33652570-33652592 CATATTTTGTATTCTGTATCTGG - Intergenic
1174085015 20:48001265-48001287 CATATTTAGTCCTCTGTGTCTGG + Intergenic
1174904261 20:54533555-54533577 CTTATTAAGCACTAAGTATTGGG + Intronic
1176882335 21:14212456-14212478 TTTATTGAGCCCTATGTATCAGG + Intergenic
1177886971 21:26759003-26759025 GATACCTAGAACTATGTATCAGG - Intergenic
1180240398 21:46499696-46499718 CATAGTTAGCTGTATGTAGCTGG + Intronic
1180738672 22:18037665-18037687 CCCATTTAGCAGTATGTCTCAGG - Intergenic
952310153 3:32181224-32181246 GAGAATTAGCACTAGGTATCTGG - Intergenic
952833737 3:37587078-37587100 CATATGTTGCATTATGTATCTGG + Intronic
957331739 3:78773758-78773780 CATATATAGCAAACTGTATCTGG + Intronic
957774048 3:84732486-84732508 CATAGTTAGCAATATGAGTCTGG + Intergenic
957894506 3:86403851-86403873 CTTATTGAGCACTATGTACTAGG + Intergenic
958678992 3:97301404-97301426 CATAGTTCTTACTATGTATCAGG + Intronic
959299385 3:104578555-104578577 GACATTTAGCACTGTGTACCTGG - Intergenic
959339714 3:105113491-105113513 CATATGCAGCACAATGTAACTGG + Intergenic
959678859 3:109069223-109069245 TATATTTATAAATATGTATCTGG - Intronic
961930840 3:130531143-130531165 CATATTTAGCACATTGAATTAGG - Intergenic
964045419 3:152318659-152318681 CATGCTAAGCACTATGTCTCTGG - Intronic
965370662 3:167857973-167857995 CATAGTTAGCTCTTTGTCTCTGG + Intergenic
966962282 3:184952365-184952387 CATTTCTGACACTATGTATCTGG + Intronic
971644503 4:29181120-29181142 CATATTTAGAAGTAAGTATCTGG - Intergenic
971895019 4:32580954-32580976 TATATTTACCACTATTTTTCAGG + Intergenic
972454011 4:39234237-39234259 TATATTTAGAATTATGTACCAGG + Intronic
974673588 4:65062319-65062341 GATAATTAGCCCTATTTATCAGG - Intergenic
975872149 4:78791701-78791723 AATATTTAGCATTTTGTGTCTGG + Intronic
977643174 4:99380358-99380380 GATATTTATCATTTTGTATCTGG - Intergenic
979039482 4:115769119-115769141 CAAATTAAGAATTATGTATCTGG - Intergenic
979927413 4:126584182-126584204 AATATTTTGAACTATTTATCTGG - Intergenic
980047930 4:128009747-128009769 CATATTTTACCATATGTATCAGG + Intronic
982433433 4:155351297-155351319 CATATTTCCCACCATGTATCAGG + Intronic
983085319 4:163436055-163436077 CCTATAAAGCACTATGTACCAGG - Intergenic
983193109 4:164775411-164775433 AATGTTTAGCTCTATCTATCTGG - Intergenic
984258003 4:177410070-177410092 CATATTTAGCTCACTCTATCTGG + Intergenic
986028974 5:3877741-3877763 AATATTTAGCATTGTGTATTAGG - Intergenic
987300374 5:16591992-16592014 CATAATCAGCACTGTGAATCTGG + Intronic
988327051 5:29783089-29783111 CATAGATAGCACTATGTGTCAGG + Intergenic
990680302 5:58235647-58235669 CATATTTAGGACTCAGTATTTGG + Intergenic
992400857 5:76410002-76410024 CTTGTTTAGCACTATGTGCCAGG - Intronic
993586262 5:89733246-89733268 CACATTTAGCACAATTGATCAGG + Intergenic
998572592 5:143276516-143276538 CATATTGATCATTATGTGTCTGG - Intergenic
998782945 5:145678518-145678540 CATATTTAGCATTATGATTTAGG - Intronic
999426789 5:151494549-151494571 CATATGTAGCCCTTTGTGTCTGG + Intergenic
1000506245 5:162122988-162123010 AATATCTTGCACTATATATCTGG + Intronic
1001693895 5:173655001-173655023 AATATTTAGCACTTTCTAACTGG - Intergenic
1003777802 6:9388893-9388915 CAGAGTCAGCACTATGTCTCAGG - Intergenic
1004143053 6:13038567-13038589 CATATTTCACACTCTGTCTCTGG - Intronic
1004994168 6:21172132-21172154 CATATAAAGCACTTAGTATCAGG - Intronic
1009590677 6:65665620-65665642 CATTTTTACAACTATGTATTAGG - Intronic
1009882138 6:69582001-69582023 GATCTTTAACACTAAGTATCTGG - Intergenic
1011060322 6:83258639-83258661 TATATCTAGCACTATGTGTCAGG + Intronic
1013427288 6:110024245-110024267 CATATTTAGCAATAAGCCTCAGG + Intergenic
1013872167 6:114778068-114778090 CATATATAGCATTATGTATCTGG + Intergenic
1014940090 6:127428117-127428139 CATTTATATCACTATGTGTCCGG + Intergenic
1015610913 6:135016991-135017013 AAGATTTAGAACTATTTATCTGG + Intronic
1016140019 6:140596665-140596687 CCTATATAGCACTGTGAATCAGG - Intergenic
1018230868 6:161673907-161673929 CATATTTGGCATTATGAAGCAGG + Intronic
1022995519 7:35751193-35751215 TTAATTAAGCACTATGTATCTGG - Intergenic
1023472726 7:40542139-40542161 GTTATTTAGCACTATGTGTCAGG + Intronic
1024204319 7:47143068-47143090 CATTTTTGCCCCTATGTATCAGG - Intergenic
1030160873 7:106507376-106507398 CACATTTATAAATATGTATCAGG - Intergenic
1032008616 7:128325675-128325697 CTTATTTAGCACTTTGTGTTAGG - Intronic
1037166890 8:15841227-15841249 TAGAGTTAGAACTATGTATCTGG - Intergenic
1037495787 8:19439511-19439533 CATTTTTAGCACTATAGATGTGG - Intronic
1042460312 8:69058157-69058179 AATATTTAGCACTTTGTGCCAGG + Intergenic
1043285230 8:78519695-78519717 AATATTAAGTACTATGTATCAGG + Intronic
1043298615 8:78698813-78698835 TTTACTAAGCACTATGTATCAGG + Intronic
1045182091 8:99795318-99795340 CATTTTTCGCACTCTGTAGCTGG + Intronic
1047341387 8:123983797-123983819 TTTATTGAGCACTATGTATGAGG - Intronic
1048481491 8:134799515-134799537 CATATATAGAACTAATTATCAGG + Intergenic
1048754021 8:137714698-137714720 CATATTTAGCATAATCTTTCTGG - Intergenic
1050376433 9:4978690-4978712 CAAATTTAACACTGTGTAACTGG + Intergenic
1051574886 9:18604017-18604039 CATATTTATCCCTATGCATTTGG + Intronic
1052105924 9:24516009-24516031 CATATGAAGTACTATGTATCAGG - Intergenic
1055466991 9:76575672-76575694 CATTTTCAGCTCTATGTATTGGG - Intergenic
1058508188 9:105688044-105688066 CATATTCAACTCTGTGTATCCGG - Intergenic
1059079459 9:111233110-111233132 GATATTTAGCACTATTTTTTAGG - Intergenic
1059716157 9:116915356-116915378 CATAATAAGAACTATGTATTTGG + Intronic
1059730380 9:117051279-117051301 AATATTTAGCACAATGTATCCGG - Intronic
1185808759 X:3085343-3085365 TATATTTATCTATATGTATCAGG - Intronic
1188191384 X:27175104-27175126 CATATTTAGCATAAACTATCTGG - Intergenic
1189649530 X:43174514-43174536 AATATTAATCACTATGTTTCAGG + Intergenic
1192085455 X:68091837-68091859 CTCACTTAGCAGTATGTATCAGG - Intronic
1194728520 X:97427230-97427252 AATATTTAGCATTATTTATGTGG + Intronic
1195829555 X:109040784-109040806 GATATTAAGCAATATGTCTCAGG - Intergenic
1196240160 X:113334325-113334347 CATTTTTAAGACTATGTATGAGG - Intergenic
1199096200 X:143743530-143743552 AATATTTAAAACTATATATCAGG + Intergenic
1199117190 X:144007174-144007196 CATATTTATTACTGTGTTTCTGG + Intergenic
1199463787 X:148113316-148113338 CTTATATAGCACTATGTGCCAGG + Intergenic