ID: 1132128097

View in Genome Browser
Species Human (GRCh38)
Location 15:99247698-99247720
Sequence AACCAGGACTTGCCTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132128097 Original CRISPR AACCAGGACTTGCCTGCAAA TGG Intronic
901718778 1:11178269-11178291 AACCAGGAGATGCCTGGAGACGG - Intronic
902611697 1:17601734-17601756 AACAAGGACTTGGCTGGACACGG - Intronic
903137178 1:21317318-21317340 AACAAGGTCGTGTCTGCAAAGGG + Intronic
905469627 1:38182072-38182094 AACCAGGACTTGAACCCAAATGG - Intergenic
906331454 1:44888413-44888435 AAACGGGACATGCCGGCAAAGGG + Intronic
906820755 1:48927534-48927556 ATCCAGGCCTTGTCTGGAAAGGG - Intronic
908734334 1:67259995-67260017 AACTAATACTTGCTTGCAAAGGG + Intergenic
909652629 1:77992653-77992675 AACCTGGACATGACTGCTAAAGG - Intronic
910845809 1:91603814-91603836 CACCAGGCCCTGTCTGCAAAAGG - Intergenic
911911040 1:103635543-103635565 AGCCAGGAATAACCTGCAAAGGG - Intergenic
911918455 1:103729685-103729707 AGCCAGGAATAACCTGCAAAGGG - Intronic
913568915 1:120100927-120100949 AACCAGGGCTTGAATGGAAAAGG + Intergenic
914289724 1:146261918-146261940 AACCAGGGCTTGAGTGGAAAAGG + Intergenic
914550768 1:148712701-148712723 AACCAGGGCTTGAGTGGAAAAGG + Intergenic
915574842 1:156768440-156768462 AAGCTGGGCTTGCCTGCAGAAGG + Intronic
916449797 1:164909509-164909531 ATCCAGGAATTGCCTAGAAAGGG + Intergenic
918146159 1:181757928-181757950 AACCATGACTTTCTTGCAGAGGG + Exonic
922192158 1:223328842-223328864 AGCCAGGACTTGCCTCCACTAGG - Intronic
922903160 1:229154179-229154201 AAACAAGACGTGCCTGTAAATGG + Intergenic
923146297 1:231200831-231200853 AAGCAGGACTTTCCAGCAAAAGG + Intronic
923997799 1:239516120-239516142 TAGCAGGACTAGCCTACAAATGG - Intronic
1062847695 10:720309-720331 ATCCAGAAACTGCCTGCAAAGGG + Intergenic
1063521056 10:6741522-6741544 AACCAGGACTGTCCTGGAACTGG - Intergenic
1065153376 10:22845236-22845258 CCCCAGGACTTGTCTGCAATTGG - Intergenic
1065609742 10:27461209-27461231 ATCCAGGAAAGGCCTGCAAAGGG + Intergenic
1067217012 10:44311445-44311467 CTCCAGGTCTCGCCTGCAAAGGG + Intergenic
1067938538 10:50632461-50632483 ATCCAGGACTTGTTTGCAAGTGG - Intergenic
1072545318 10:96432650-96432672 GGCCAGGACTTGCCGGCAAGAGG + Intronic
1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG + Intronic
1074048763 10:109864051-109864073 AACAAGGATTTGCATGTAAATGG + Intergenic
1076259765 10:129055996-129056018 AACCAGGACTTGGCTGGCAGGGG - Intergenic
1076749703 10:132536781-132536803 AACCGGGACATGCCTGTAGATGG - Intergenic
1078325891 11:10380475-10380497 AACAAGGATTTGAGTGCAAATGG + Intronic
1080575424 11:33594523-33594545 AGCCAGGACTAGCCTGCTAGAGG - Intronic
1084470942 11:69358630-69358652 AGCCTGGACCTGCCTGCAAAGGG - Intronic
1085412902 11:76302073-76302095 ATCCAGGACTTGCCAGGAAGGGG + Intergenic
1089068001 11:115676641-115676663 AACCAGCACTTACAGGCAAAAGG - Intergenic
1090808141 11:130215657-130215679 AGCCAGGAGGTGCCTGCAGAGGG + Intergenic
1095722990 12:45421264-45421286 AAGCAGAACTTGCCTGCATGTGG - Exonic
1096120604 12:49087171-49087193 ATCCATGACTTGCCTTCAAGCGG - Intergenic
1096165956 12:49424338-49424360 AACCAGAACATACCTGCATAGGG + Intronic
1096389193 12:51216593-51216615 GACCAGGACTTGAATGAAAATGG + Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1100904085 12:99277674-99277696 AACCAGATCTTGACTGCATAGGG - Intronic
1101860136 12:108475926-108475948 AACAAGGACTTGAGTGCAAGTGG - Intergenic
1106316977 13:28602969-28602991 AACCAGCAATTGCCTTCCAAGGG + Intergenic
1106661367 13:31803166-31803188 AAGCAGAACTTGCCAGCAATAGG - Exonic
1108981270 13:56518304-56518326 AGGCAGGACTTGCATGTAAACGG + Intergenic
1111032222 13:82617565-82617587 AGCCATGACATGCTTGCAAAAGG + Intergenic
1114894056 14:26963731-26963753 AAACAGGAATTGCCTGGGAAAGG - Intergenic
1119541221 14:75439294-75439316 AGCCAGGTCCAGCCTGCAAATGG - Intronic
1120267113 14:82265103-82265125 TACAAGTACTTGCCAGCAAATGG - Intergenic
1121837136 14:97102261-97102283 AAGTAGGACTGGCCTGCAAGTGG - Intergenic
1124439704 15:29677072-29677094 TCCCAGCTCTTGCCTGCAAAGGG + Intergenic
1126193246 15:45901191-45901213 AAGCAGGAATTGCATGCAAATGG + Intergenic
1127972686 15:63973875-63973897 AACCAGGGCCTGCCTGGAGAAGG - Intronic
1128463885 15:67892177-67892199 TAGCAGGACATGCCTGCTAAAGG - Intergenic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132209622 15:100010351-100010373 AATCAGGAGGTGCCTGCACAGGG + Intronic
1133104072 16:3495448-3495470 AACCAGGACTTGGGTGCAGCAGG + Intronic
1133162408 16:3920721-3920743 AACGAGGAACTGCCTGCAGAAGG - Intergenic
1135457914 16:22614796-22614818 AACCAGGACATTCTTGAAAAAGG - Intergenic
1140493935 16:75366774-75366796 GAGCAGGAATTGACTGCAAATGG + Intronic
1148560952 17:48605705-48605727 AACCTGGACTTGCCTGCATTTGG - Intergenic
1154271583 18:12925231-12925253 AACCGGGACTTCCCAGCTAATGG + Intronic
1157195811 18:45619369-45619391 GCCCAGTCCTTGCCTGCAAAGGG - Intronic
1158103514 18:53858389-53858411 AAACAGGGCTTGCCTGCAAATGG + Intergenic
1159834848 18:73325667-73325689 AAGCGGGACTTGGCTGCTAAGGG - Intergenic
1162962125 19:14134591-14134613 AAGCAGGACTTGCCTGTTAGTGG + Intronic
1163785751 19:19274127-19274149 ACCCGGGACTAGCCTGCAAAGGG - Intergenic
1164479686 19:28601905-28601927 AAGGAAGACTTGCCTGAAAAGGG - Intergenic
1166345559 19:42163190-42163212 AACCAGGAATGGCCCACAAAGGG + Intronic
1166389397 19:42400704-42400726 ACCCAAGACATGCCTTCAAAGGG - Intergenic
1168173574 19:54607374-54607396 GGCCAGGACGTGGCTGCAAATGG - Intronic
1168246777 19:55116566-55116588 AAGCAGGACCTGCCTGGGAAGGG + Intronic
925915081 2:8599412-8599434 AACCAGGACTGGGCTGCAGGAGG + Intergenic
927015896 2:18961412-18961434 TGCAAGGCCTTGCCTGCAAAAGG + Intergenic
928095855 2:28404624-28404646 AGCCAGGACTTGGCTACAGATGG + Intronic
928428487 2:31199032-31199054 AGGCAGGACCTGCCTACAAAGGG - Intronic
928456826 2:31429993-31430015 AACTAGGACTTTCCAGAAAACGG + Intergenic
931953044 2:67386617-67386639 ACCCAGTAGATGCCTGCAAAGGG + Intergenic
934751772 2:96798421-96798443 AACCAGCACACGTCTGCAAAGGG - Intronic
934980333 2:98834071-98834093 AATCAGGACCTCCCTGCCAAGGG + Intronic
935038165 2:99399172-99399194 AAACAGGGCTTGCCTGCCTAAGG - Intronic
937428430 2:121818359-121818381 ACCCAGGGCTGACCTGCAAAGGG - Intergenic
939184808 2:138847701-138847723 TCCCTGGACTGGCCTGCAAAGGG - Intergenic
941038049 2:160589446-160589468 AACCAGACATTGGCTGCAAATGG + Intergenic
942155421 2:173122548-173122570 AACCTGGCCTTCCCTTCAAAGGG + Intronic
942422649 2:175823700-175823722 AGCCAGGGCTTGCGTGCCAATGG + Intergenic
942951877 2:181730525-181730547 GACCAGAATTTGACTGCAAATGG - Intergenic
946061485 2:216945276-216945298 AACAAGAACTTGCATGCAAGTGG - Intergenic
946902854 2:224389218-224389240 CACCACAACTGGCCTGCAAAGGG + Intronic
947321291 2:228921715-228921737 AAACTGGGCTTGACTGCAAATGG + Intronic
1172836155 20:37874578-37874600 AACCAGGTAATGCTTGCAAACGG + Intergenic
1173755001 20:45508221-45508243 AACCAGGATCTGCGTGCACAGGG + Intergenic
1175167490 20:57055041-57055063 AACCTGTAACTGCCTGCAAAGGG + Intergenic
1178476137 21:32938984-32939006 AAACAGGACTTGGTCGCAAATGG + Intergenic
1180961464 22:19764228-19764250 CACCCGGACTCGCCTGCCAAGGG + Exonic
950014302 3:9745001-9745023 AACCAAGACTTACCAGCCAATGG + Exonic
952447274 3:33393783-33393805 AAACAGGAATTGGCTGCAAATGG + Intronic
952962904 3:38603988-38604010 ACCCAGGTCTCGCCTGCGAAAGG + Exonic
955724820 3:61922079-61922101 AAGCAGGATATGCCTGCAGAAGG - Intronic
955963450 3:64364149-64364171 ATCCAGGACTTGCATCCATAGGG - Intronic
956487834 3:69740368-69740390 ATCCAGGCCTTACCTGCAGAGGG + Intronic
957673430 3:83335668-83335690 AAACAGCACTTGGCTGGAAAAGG - Intergenic
958100299 3:88999862-88999884 TCCCAGTACTCGCCTGCAAAAGG + Intergenic
961591538 3:127985156-127985178 AGCCAGGACTACCCTGCAGATGG - Exonic
962790098 3:138803599-138803621 TCCCAGGACTTTTCTGCAAAAGG - Intronic
964283513 3:155092849-155092871 AAGCAGGGATTGGCTGCAAATGG + Intronic
966536139 3:181036313-181036335 AAACAGGACTTTCCAGCATAAGG - Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
970005342 4:11405458-11405480 AAGGAGGCCTTTCCTGCAAATGG + Intronic
970779777 4:19722740-19722762 GACAAGGACTTGACTTCAAATGG + Intergenic
974523237 4:63012845-63012867 AAGCAGGACGTTCCTGCATAAGG + Intergenic
978593950 4:110356523-110356545 CTCCAGTTCTTGCCTGCAAATGG + Intergenic
979302799 4:119106752-119106774 ACCCAGGACTTGAATGCAAGAGG - Intergenic
979381570 4:120012520-120012542 CATCAGGAGTTGCCTGCCAAGGG + Intergenic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
987103494 5:14613852-14613874 TCCCAGGACTTTTCTGCAAATGG + Intronic
988157793 5:27477169-27477191 AAACATGACATGCCAGCAAAAGG + Intergenic
988930560 5:36032288-36032310 AACTATGACTTAGCTGCAAATGG + Intergenic
989262856 5:39437844-39437866 AGTCAGGACATGGCTGCAAAGGG + Intronic
991096768 5:62748164-62748186 AACCAAGACCTGTCTGCCAATGG - Intergenic
992190356 5:74285647-74285669 AACCACCACTTGTCTGGAAAAGG - Intergenic
992650695 5:78856375-78856397 AACCAGGACTTGTTTTCAAGGGG - Intronic
994457833 5:100035027-100035049 AATCAGGAAATGACTGCAAATGG + Intergenic
995833318 5:116377085-116377107 AACCAGGACTTTTGTGGAAATGG - Intronic
995848669 5:116521497-116521519 ACCCATGACTTGTCTGCAGAGGG - Intronic
997310436 5:132875331-132875353 AAACAGGAATTGCATGAAAAGGG + Intergenic
998227540 5:140338649-140338671 AGCCAGGAGTTGTCTGCAAAGGG - Intronic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1003017736 6:2481583-2481605 AGCCAGGGATAGCCTGCAAACGG - Intergenic
1003129946 6:3386838-3386860 AACAAGGACTTGCTTCCACAGGG + Intronic
1003352829 6:5334937-5334959 AAACAGGGCTTGCCTACACATGG - Intronic
1005010750 6:21333098-21333120 AACCAGGATTGGCCTTAAAAAGG + Intergenic
1005037492 6:21570115-21570137 CACCAGCACTTGCCTGGGAATGG + Intergenic
1007624369 6:43235121-43235143 GAGCAGGAATTGCCTGCAGAGGG + Intergenic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1009735691 6:67673948-67673970 AAGCATGACATGCCAGCAAATGG - Intergenic
1013100387 6:106981470-106981492 ATTCAGGATCTGCCTGCAAATGG - Intergenic
1015124662 6:129740408-129740430 GAGCAGGACTTGGCTGAAAAGGG + Intergenic
1015615852 6:135074185-135074207 AACAAAGACATGCCTGCAGAAGG + Intronic
1015812405 6:137173914-137173936 AACCAGGTCTTGGTAGCAAAGGG + Intergenic
1015813486 6:137184917-137184939 AAGCATGACATGCCAGCAAAAGG - Intergenic
1016400210 6:143672082-143672104 AAACAGGAATTAACTGCAAAAGG + Intronic
1017452361 6:154565930-154565952 AGCCAGGCATTGCCTGAAAATGG + Intergenic
1019270721 7:146469-146491 AAACAGGACTTTCCAGCATAAGG - Intergenic
1019423121 7:960555-960577 AACGAGAACTTGCATGCACAGGG - Intronic
1022499534 7:30873794-30873816 AACTCGAACTTGCCTGAAAAAGG + Intronic
1034231345 7:149531015-149531037 AAGCCGGACATGCCAGCAAAAGG + Intergenic
1034241658 7:149615958-149615980 AGCCAGGACTTGCGTCTAAAAGG + Intergenic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1037307976 8:17525761-17525783 AACCAGCACATTCCTGCAAGCGG + Intronic
1037676474 8:21055385-21055407 AACCAGGACTTGACTGAATATGG - Intergenic
1038692943 8:29779804-29779826 AGTCAGGAGTGGCCTGCAAAGGG + Intergenic
1061060131 9:128246105-128246127 ATCCAGGACTTGCCTGGGGAGGG + Intronic
1062573351 9:137195469-137195491 ACCCAGGATCTGCCTGCACAGGG + Intronic
1189337804 X:40181218-40181240 AACCAGGACTAGACCCCAAAAGG - Intergenic
1192927166 X:75767258-75767280 ATTCTGGACTTGCCTGAAAATGG + Intergenic
1195860794 X:109380685-109380707 AATCAGGACTTAACTTCAAAAGG - Intronic
1198466051 X:136905793-136905815 AACCAGGAGCTGCTTTCAAATGG + Intergenic
1198860885 X:141069223-141069245 ATCAAGGACTTGGCTTCAAAGGG - Intergenic
1198901807 X:141518160-141518182 ATCAAGGACTTGGCTTCAAAGGG + Intergenic