ID: 1132132581

View in Genome Browser
Species Human (GRCh38)
Location 15:99296592-99296614
Sequence CTGACCACACATATACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132132581_1132132585 29 Left 1132132581 15:99296592-99296614 CCAGGCTGTATATGTGTGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1132132585 15:99296644-99296666 TGTGGGGTTATCTGCATGACTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1132132581_1132132582 11 Left 1132132581 15:99296592-99296614 CCAGGCTGTATATGTGTGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1132132582 15:99296626-99296648 AATAGATTTTCTCTATTTTGTGG 0: 1
1: 2
2: 4
3: 66
4: 645
1132132581_1132132584 13 Left 1132132581 15:99296592-99296614 CCAGGCTGTATATGTGTGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1132132584 15:99296628-99296650 TAGATTTTCTCTATTTTGTGGGG 0: 1
1: 0
2: 1
3: 46
4: 518
1132132581_1132132583 12 Left 1132132581 15:99296592-99296614 CCAGGCTGTATATGTGTGGTCAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1132132583 15:99296627-99296649 ATAGATTTTCTCTATTTTGTGGG 0: 1
1: 0
2: 5
3: 59
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132132581 Original CRISPR CTGACCACACATATACAGCC TGG (reversed) Intronic
902671263 1:17975732-17975754 GCAACCAGACATATACAGCCAGG + Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
908649514 1:66316549-66316571 CTGAACACACACATACAGACAGG - Intronic
909169452 1:72276394-72276416 CTGATCACACATCTACAAGCAGG + Intronic
910653235 1:89592526-89592548 TTGCCCACCCATATACAGCAAGG + Intronic
911390119 1:97231078-97231100 CTGAGCACACATCTACACCCAGG + Intronic
915422703 1:155797539-155797561 ATAAACAGACATATACAGCCTGG + Intronic
917418113 1:174832706-174832728 ATGAACACACAGAGACAGCCAGG - Intronic
917494273 1:175525832-175525854 ATGACCACCCATATACAGAAGGG + Intronic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
1064967437 10:21029573-21029595 CTGACAAAACAGATACAGACTGG + Intronic
1065424248 10:25582512-25582534 ATGGCCACACATTTACAGGCTGG - Intronic
1066672201 10:37852311-37852333 CTGTTGACACATATACAACCCGG + Intronic
1070174985 10:73962592-73962614 CAGAATACACATATACAACCTGG + Intergenic
1076595447 10:131622309-131622331 CTGACCTCACAAATCCAGGCAGG - Intergenic
1083779724 11:64911548-64911570 ATGAACCCAGATATACAGCCTGG + Intronic
1083833489 11:65248707-65248729 CTGACCAGGCCTACACAGCCAGG - Intergenic
1084464307 11:69313308-69313330 CTGTCCACACTTACAAAGCCAGG - Intronic
1084960289 11:72712936-72712958 ATGCCCACCCACATACAGCCAGG + Intronic
1084972785 11:72780865-72780887 CTGGGCCCAGATATACAGCCAGG + Intronic
1087841695 11:102927402-102927424 CTGGCTAGACATATACAGTCTGG - Intergenic
1087989122 11:104725893-104725915 CTGATCAAACAAATACAGCATGG - Intergenic
1088917261 11:114237125-114237147 CTCACCATAAATATGCAGCCAGG + Intronic
1089123746 11:116161662-116161684 AAGACCACACATATACAAGCAGG + Intergenic
1090959777 11:131545957-131545979 CTGACTACCCATAAACAGCTGGG - Intronic
1096644410 12:53022535-53022557 CTGACAAAACAGATACAGACTGG + Exonic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105365429 13:19760021-19760043 ATGACCACACATATAAAACATGG - Intronic
1107924857 13:45248823-45248845 CTGATCACTTAGATACAGCCAGG - Intronic
1112589933 13:100753681-100753703 TTGAACACAAATATACACCCTGG + Intergenic
1113757289 13:112821907-112821929 CAGACAACCCATATGCAGCCTGG + Intronic
1117013054 14:51490548-51490570 CTATACACACGTATACAGCCAGG - Intronic
1122399843 14:101460129-101460151 CTGAGCACACTAAAACAGCCAGG - Intergenic
1127742000 15:61917937-61917959 CTGACATCAAATATACAGTCAGG + Intronic
1131825931 15:96322581-96322603 CTGATCACACACAAATAGCCGGG - Intergenic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1135990351 16:27215112-27215134 CCGACCACAGACTTACAGCCTGG - Intronic
1137025304 16:35468212-35468234 CTTCCCACACATAGATAGCCTGG - Intergenic
1137218617 16:46425609-46425631 CTGAGCACACCAACACAGCCAGG + Intergenic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1143325967 17:6098633-6098655 CTGACCACGCAGAGGCAGCCCGG - Intronic
1147034957 17:37672934-37672956 CTGCCCACACATACACTGCTAGG - Intergenic
1147505139 17:41008809-41008831 CTGACCACCTATGTTCAGCCTGG - Exonic
1151198205 17:72446779-72446801 CTCTCCATATATATACAGCCAGG - Intergenic
1151475727 17:74343506-74343528 CTGAACATACATGTACAGTCTGG + Intronic
1153806819 18:8715944-8715966 CTGAACACACATAAACAGAATGG - Intronic
1155158481 18:23177484-23177506 CTGACCACACATAGACCGGCGGG - Intronic
1157127436 18:44970235-44970257 CTGACCAAAGAGATCCAGCCAGG + Intronic
1159105926 18:64002269-64002291 CTGACCCCATATACAGAGCCAGG - Intronic
1161677618 19:5661299-5661321 CTGATCACACACACACAGCCTGG + Intronic
1162309143 19:9894851-9894873 CTGAGGACATATATACAGGCAGG - Intronic
1165428831 19:35760102-35760124 CTTAACACACATAAACTGCCTGG - Intronic
1165999086 19:39867008-39867030 TTGACCTCACATACACGGCCTGG + Exonic
1202713420 1_KI270714v1_random:29502-29524 ATGAACACACATACAGAGCCAGG - Intergenic
925061125 2:890997-891019 CTGACCACACATGGAAAGCAGGG + Intergenic
925233445 2:2256148-2256170 CTGTGCTCACATCTACAGCCCGG - Intronic
925586722 2:5471921-5471943 CAGACCACAGATACACAGGCAGG + Intergenic
926808686 2:16737037-16737059 CTGAGCAGAAATATACAGGCTGG + Intergenic
932338076 2:70942472-70942494 TTGACCACACATATCCAGACTGG + Intronic
935315347 2:101827986-101828008 CTGAACACACATACACTCCCAGG + Intronic
941086300 2:161122015-161122037 CTGACCACACTTAAATAGCAAGG + Intergenic
945690932 2:213034630-213034652 CGAACCACACCTATACAGGCTGG - Intronic
946475242 2:220000650-220000672 CTTCCCACACACAGACAGCCAGG - Intergenic
948040583 2:234898483-234898505 TTGACCACACTTTTACAGGCTGG - Intergenic
1169818861 20:9687127-9687149 CTGAGCAAAGCTATACAGCCTGG - Intronic
1172618326 20:36304873-36304895 CTGATCATATATATACCGCCAGG + Intergenic
1173156623 20:40618072-40618094 GTGACCACAGTTATAAAGCCGGG + Intergenic
1173595544 20:44256852-44256874 CTGCCCACACTCACACAGCCAGG + Intronic
1173625223 20:44467455-44467477 GTGACCACAAAAACACAGCCAGG + Intergenic
1175724412 20:61307869-61307891 CTGATCTCACATATCCTGCCTGG + Intronic
1178737719 21:35167723-35167745 CTGACCACAGACACACACCCAGG - Intronic
1184457183 22:44617371-44617393 CACACCACACATATACACACAGG + Intergenic
953883566 3:46703581-46703603 CTGACCCCACACATATATCCAGG + Intronic
956243474 3:67154953-67154975 CTGACCCCACATATACTGATGGG + Intergenic
961778449 3:129306929-129306951 CTGGCCACACCTAGACAGGCAGG - Intergenic
970504920 4:16718525-16718547 ATGACTACACATATACAGGTTGG - Intronic
972379974 4:38510465-38510487 CTGACCACACATCAACAGAGGGG + Intergenic
977581947 4:98735320-98735342 CAGATCACAAATATACAGCTAGG - Intergenic
983679268 4:170333508-170333530 CTAACCACACAGATACACACAGG - Intergenic
984642917 4:182189762-182189784 CTGAGCACACTCATGCAGCCTGG - Intronic
985571419 5:647576-647598 CAGACCACACAGCTGCAGCCTGG + Intronic
989479304 5:41911103-41911125 ATGACAATACATATACAGCAGGG - Exonic
991975900 5:72183527-72183549 CCGACCACACAAACCCAGCCTGG + Intronic
992409224 5:76489023-76489045 CTGACCCCAGATGTAAAGCCAGG + Intronic
997822431 5:137078196-137078218 CTGAGCCCACATATCCAGGCTGG - Intronic
998127584 5:139634857-139634879 CTGCACACACACATACAGGCTGG - Intergenic
1001982886 5:176048318-176048340 CAGACCACACCTAAACACCCAGG - Intergenic
1002234577 5:177795739-177795761 CAGACCACACCTAAACACCCAGG + Intergenic
1004329025 6:14704556-14704578 CTGACCACAAATGTTCATCCCGG - Intergenic
1006653718 6:35572233-35572255 GAGATCACACATTTACAGCCAGG + Intergenic
1006685038 6:35825653-35825675 CTCAAAACATATATACAGCCTGG - Intronic
1018541622 6:164886357-164886379 GTGACCCCACATATACAGGTAGG - Intergenic
1019746979 7:2706144-2706166 CTGACCCCACAAATGCAACCTGG - Intronic
1023938521 7:44755982-44756004 CTGCCCCCACAAATACAGCCTGG - Intronic
1024083821 7:45877347-45877369 CTGACCACTTATTTACATCCTGG - Intergenic
1026263647 7:68777457-68777479 GTGACCACACAAATTGAGCCTGG + Intergenic
1026610146 7:71851250-71851272 CACATCACACATATACAGCTGGG + Intronic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1029894217 7:103964834-103964856 GTGCCCACACAAATACAGTCAGG + Intronic
1029958811 7:104668323-104668345 CTGACAAAACAGATACAGACTGG + Intronic
1037867362 8:22456623-22456645 CTAAACACACATACACAGACAGG - Intronic
1039358195 8:36844575-36844597 CTGAACACAGCTATATAGCCTGG + Intronic
1039748635 8:40456439-40456461 CTTATCACACATATAAATCCTGG + Intergenic
1039787836 8:40849278-40849300 CTAACCAAACAAACACAGCCAGG + Intronic
1043494288 8:80783116-80783138 CTGAACACACATGTTCAGTCTGG - Intronic
1044611814 8:94099194-94099216 CCCACCACGCATATACAGCCTGG - Intergenic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1048952996 8:139511465-139511487 CTGAGCCCACATATCCAGACTGG - Intergenic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1058675617 9:107397624-107397646 CAGACCACACAAAAACAGGCCGG - Intergenic
1061457157 9:130707161-130707183 CTCTCCAGAGATATACAGCCTGG - Intergenic
1061978886 9:134088389-134088411 GTGACCACACATACACAGTGGGG - Intergenic
1062522629 9:136964555-136964577 CAGGCCACACAAACACAGCCGGG - Intergenic
1189479097 X:41379562-41379584 TTTACCACACATACACACCCAGG + Intergenic
1190279152 X:48918237-48918259 TTTCCCACACATACACAGCCTGG + Intronic
1191904654 X:66075760-66075782 CTGACAAAACAGATACAGACTGG - Intergenic
1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG + Intergenic
1197900217 X:131363544-131363566 CTTGCCACACATTTACAGCACGG - Intronic