ID: 1132136077

View in Genome Browser
Species Human (GRCh38)
Location 15:99340584-99340606
Sequence ATCTGCAGTTTGAAGAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132136077 Original CRISPR ATCTGCAGTTTGAAGAACTA TGG Intronic
902085375 1:13856144-13856166 TTCTGCAGACTGAAGAACTGTGG - Intergenic
904633284 1:31859818-31859840 ATCTGCAAGCTGAAGAGCTAGGG + Intergenic
905280035 1:36843179-36843201 ATATGCAGTGTGAGGAACTGTGG + Intronic
906397467 1:45479400-45479422 TTCTGCAGTATGGAAAACTAGGG - Intronic
906718505 1:47988235-47988257 ATCTGAAGTGTGGAGAACCAGGG + Intronic
907082374 1:51635587-51635609 ATCAGTAGTTTGCAGAACTTGGG + Intronic
907874137 1:58469517-58469539 AGCTGGAGTTTACAGAACTAAGG - Intronic
908890918 1:68846871-68846893 ATTTGAAGTTAGAAGAACTGAGG + Intergenic
909410851 1:75349655-75349677 AAATGCAGAGTGAAGAACTATGG + Intronic
910415908 1:86997947-86997969 ATCTGCAGTTTCACGACCCATGG - Intronic
910956432 1:92711181-92711203 ATTTGGAGTTTGAAGTACTTGGG + Intronic
911820243 1:102410128-102410150 AGCTGCATTTAGATGAACTATGG + Intergenic
911912501 1:103653771-103653793 TTCTGCACTCTGAATAACTAAGG + Intergenic
911915953 1:103698177-103698199 TTCTGCACTCTGAATAACTAAGG - Intronic
911919913 1:103747909-103747931 TTCTGCACTCTGAATAACTAAGG + Intronic
912373170 1:109189240-109189262 ATGTGAAGTTGGAAGAACTGAGG - Intronic
913563637 1:120048369-120048391 ATCTGCAGTGTAAAAAACAATGG + Intronic
913634487 1:120745208-120745230 ATCTGCAGTTTAAAAAACCATGG - Intergenic
913690122 1:121271585-121271607 ACCTGCAGTTTGAAAAGCTGTGG - Intronic
914147418 1:145008378-145008400 ACCTGCAGTTTGAAAAGCTGTGG + Intronic
914284232 1:146207735-146207757 ATCTGCAGTTTAAAAAACAATGG + Intronic
914545263 1:148658474-148658496 ATCTGCAGTTTAAAAAACAATGG + Intronic
914621305 1:149412205-149412227 ATCTGCAGTTTAAAAAACAATGG - Intergenic
914952615 1:152130279-152130301 AGCTGAAGTTGGGAGAACTAAGG + Intergenic
915206642 1:154274942-154274964 TTCTGCAGTTTGATGATGTATGG + Exonic
915911015 1:159915555-159915577 GTCTGCAGTTAGATGAATTAAGG + Intergenic
917571568 1:176271190-176271212 ATTTGCAGGTTGATGAACTTGGG - Intergenic
917686028 1:177416832-177416854 TTCTGAAGTTTGAATAACAAGGG + Intergenic
917794053 1:178520324-178520346 ATCTTCATTTTGAAGGACTTTGG - Intronic
918464663 1:184808809-184808831 GTATCCAGTTTGAAGAACTGGGG + Intronic
918547903 1:185706906-185706928 ATCAGAAGTTTGAAGAAGCAAGG - Intergenic
918605770 1:186423950-186423972 ATCTGCAGTGTGAAAGACTGAGG - Intergenic
920477444 1:206290066-206290088 ACCTGCAGTTTGAAAAGCTGTGG - Intronic
923078131 1:230628534-230628556 ATGTGCAGTCTCAAAAACTATGG + Intergenic
923344238 1:233035632-233035654 ATCTGCAGTTTGAAAAGCACAGG - Intronic
923727484 1:236519817-236519839 AGCTGAAGTTTGAAGAACACTGG - Intronic
923944589 1:238869982-238870004 GACTGCAGTTTAAAGAACTGGGG + Intergenic
924578966 1:245306698-245306720 ATATCCAGTTTGACGAATTATGG - Intronic
1063132509 10:3190361-3190383 ATCTGCATTTTGAATAAAAAGGG + Intergenic
1063155862 10:3378770-3378792 ACCTGCAGCTTGAAGGAATAAGG - Intergenic
1066038378 10:31518611-31518633 ATTTGCACATTGAAAAACTAAGG + Intronic
1066252142 10:33644599-33644621 AGGTGTAGTTTGAAGAACTGAGG - Intergenic
1066428309 10:35329600-35329622 ATCTCCAGTATGAAGGACAAAGG + Intronic
1068226495 10:54113473-54113495 ATCTGTAGTGTGAAGAAATGTGG + Intronic
1070177238 10:73981617-73981639 ATCTGCAGTCTAAAGAGCTCTGG - Intergenic
1071696433 10:87878551-87878573 AGCTGCATTTTGAAAAAATAGGG - Intronic
1073937837 10:108655452-108655474 AACTTCATTTTGAAGAACTAAGG - Intergenic
1076224575 10:128763910-128763932 ACCTGGTGTTTGCAGAACTAGGG + Intergenic
1077845736 11:6022521-6022543 ATCTGGAGTATGAAAAACTTAGG + Intergenic
1078923409 11:15852285-15852307 ATCTGGGGTCTGAAGAACTTAGG - Intergenic
1080015706 11:27504861-27504883 ATCTGCAGTTGGTTGAAATATGG + Intronic
1080584627 11:33670355-33670377 GTCTACAGTTTGCAGAGCTATGG + Exonic
1080692070 11:34566572-34566594 ATCTGCAGGTGGAAGAAGGAAGG - Intergenic
1081014856 11:37864065-37864087 TTCTGCAGATTGGAGAATTATGG + Intergenic
1081084956 11:38787799-38787821 ACCTGCACTTTTAAGACCTAAGG - Intergenic
1084453970 11:69256791-69256813 AGCTGTACTTTGAAGAACGAGGG + Intergenic
1084487707 11:69460214-69460236 ATCTGAATTTTGAAGAAGTTAGG - Intergenic
1084551111 11:69842772-69842794 TTCTGCAGATTGAGGAACTGAGG - Intergenic
1085490916 11:76916035-76916057 ATCTGCATTTTTAATAATTAAGG + Intronic
1085650061 11:78259752-78259774 ATCTACAGTTTGAGAAACTGTGG + Intronic
1086565096 11:88216705-88216727 ATCTGTAGTTTGAAGACCACTGG + Intergenic
1087213922 11:95474131-95474153 ATCTGAAGTTTGAAACACTTCGG - Intergenic
1090119721 11:124013602-124013624 ATCTGCAGTTTACAGAACCCAGG - Intergenic
1090304391 11:125678242-125678264 AACTGAAGTTTGATGATCTATGG + Exonic
1094686691 12:32723744-32723766 AGCTGCATTTAGATGAACTACGG + Intronic
1095170430 12:39028503-39028525 ATCTGATGTTTGAAAAACAATGG + Intergenic
1096008028 12:48187780-48187802 ATCTTCAGTTTGGAGAAATAAGG + Intergenic
1098894833 12:76046464-76046486 AGCTGCATTTCGATGAACTATGG + Exonic
1099455376 12:82856630-82856652 ATCTGCATTTTTAAGAAGCAAGG - Intronic
1099614750 12:84920009-84920031 TTTTGCAGTTTGAAGTGCTATGG + Intergenic
1101166899 12:102046914-102046936 ATCTGTAGTTTGAAAAATAAAGG + Intronic
1102655908 12:114482063-114482085 ATCTGCTGTGTGCAGAATTATGG + Intergenic
1103789151 12:123457199-123457221 ATCTGCAGTTTCAGCTACTAGGG - Intergenic
1104567346 12:129897091-129897113 ATCTGCTGTAGGAAGAATTAAGG - Intronic
1106175715 13:27329508-27329530 ATCTTCAGAGGGAAGAACTAAGG - Intergenic
1107207055 13:37804429-37804451 ATCTGAAATGAGAAGAACTATGG + Intronic
1108123165 13:47211777-47211799 ATTTGCAGTTTGGAGAAATCTGG + Intergenic
1110214383 13:73010297-73010319 ACCTGCAATTTAAAGAACAATGG + Intronic
1110339318 13:74370405-74370427 ATCTGCAAGCTGAAGAACCAGGG - Intergenic
1110392955 13:74996690-74996712 AACAGCATTTTGAAGAACTACGG - Intergenic
1111752705 13:92355352-92355374 ATCTGCAGTATTAAAACCTAAGG + Intronic
1112911395 13:104489442-104489464 ATATGCAGTTGTAAGAAATAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115674656 14:35657723-35657745 ATCTACAGTCTTAAGCACTAAGG + Intronic
1116199878 14:41778628-41778650 AACTACAATGTGAAGAACTATGG + Intronic
1116481975 14:45402078-45402100 ATCTCCAGTTTGAATCACTAAGG - Intergenic
1117779769 14:59220607-59220629 ATCTGCAAGCTGGAGAACTAGGG + Intronic
1119092832 14:71800717-71800739 ATCTGTAGTTGGAAGGGCTAAGG - Intergenic
1119611873 14:76070331-76070353 CTCTGCTGTTTGAAGAAGAAGGG - Intronic
1121081706 14:91114001-91114023 CTCTGCAGCTTTAAGAACTGGGG + Intronic
1121132152 14:91458197-91458219 ATCTGCAGTTTGAAGGGCAAAGG + Exonic
1122631842 14:103110834-103110856 TTCTGCAGCTTGAAGAATTTGGG + Intergenic
1123825946 15:24082249-24082271 ATCTTCAGAGTGATGAACTAGGG - Intergenic
1124195292 15:27620256-27620278 TTCTTCAGTGTGAAGAACTACGG + Intergenic
1126267297 15:46769550-46769572 ATCTGAATTTTGGAGAACTCAGG + Intergenic
1127653019 15:61027765-61027787 ATTTGAAGTTAGAAAAACTATGG + Intronic
1132136077 15:99340584-99340606 ATCTGCAGTTTGAAGAACTATGG + Intronic
1134536647 16:15031727-15031749 ATCTTCAGTTTTAGGAACTCGGG + Exonic
1135721886 16:24824431-24824453 CTCTGCAGTTTGAAAAACTGTGG + Exonic
1135899135 16:26440197-26440219 ATCTGGACCTTGAAGAACTAAGG - Intergenic
1136673999 16:31882632-31882654 ATAACCAGTTTGAAGATCTATGG + Intronic
1138823916 16:60295544-60295566 ATCTGCAAATTGAAGAAATAGGG - Intergenic
1139287004 16:65824549-65824571 ATTTACAGATTGAAAAACTAAGG - Intergenic
1139325679 16:66151045-66151067 ATTTGCAGGTGGAAAAACTAAGG + Intergenic
1140321596 16:73957883-73957905 ATCTGCATTTTGGAGAAATGAGG + Intergenic
1141707502 16:85675600-85675622 ATCTGCAGTTTGTAGCAGAATGG + Exonic
1146991371 17:37275979-37276001 ACCTGCAGTTTGAGCCACTATGG + Exonic
1148520865 17:48273881-48273903 ATCTCCAGGTTTAAGAACTCTGG + Intronic
1149659678 17:58327753-58327775 CTCTGCAGCTTCAAGAACTGAGG - Exonic
1150276797 17:63903552-63903574 ATCTGCAATTTGGAAAGCTATGG - Intergenic
1151386918 17:73760623-73760645 AGCTGCAGTTTGAAGGACACAGG + Intergenic
1153211452 18:2770501-2770523 ATCTGCAGTTTGTCATACTATGG + Intronic
1153959873 18:10131706-10131728 ATCTGCAGTTTTCAGAACTGTGG - Intergenic
1154996591 18:21646457-21646479 ACCTGCAGTTTGAAAAACACTGG - Intergenic
1155403276 18:25461467-25461489 AACTACAGCTTGAAGGACTAAGG + Intergenic
1157793470 18:50554579-50554601 ATCTGTAGTTTGAAAAACACAGG + Intergenic
1158367800 18:56758572-56758594 ATCTGAATATTGAAGAACAAAGG + Intronic
1160035063 18:75292963-75292985 ATCTCTAGTTTGTAGAAATATGG - Intergenic
1160156464 18:76437469-76437491 ATATGCAATTTGAAGAATCAAGG - Intronic
1164656216 19:29923959-29923981 ATCTGCAGGTTGAAGAGCCACGG + Intronic
1166939550 19:46354483-46354505 ATCTGCACTTTGAAGAAAAGAGG + Intronic
925938411 2:8790432-8790454 ATATGTAGTTTGAAGATATAGGG - Intronic
926105181 2:10145520-10145542 ATCTGCAGTTAGAACAACACTGG + Intronic
927025294 2:19062574-19062596 ATATGCATTTTGAAGCACTGGGG - Intergenic
927643872 2:24862737-24862759 ATATGCAGTTAGAAAAACTCAGG - Intronic
928547304 2:32340490-32340512 ATCAACAGTTTCCAGAACTAGGG - Intergenic
930459614 2:51656017-51656039 ATCAGCAACTTGAAGTACTAAGG - Intergenic
931007100 2:57863554-57863576 ATCAGAACTTTGAAGAATTAGGG + Intergenic
932012924 2:67995994-67996016 TACTGAAGTTTGAATAACTATGG - Intergenic
933130917 2:78673292-78673314 ATTTGCAGTTTGATGGCCTAAGG + Intergenic
935690234 2:105724660-105724682 ATTTGCAGTTTGCAAAAATATGG + Intergenic
938740162 2:134223947-134223969 ATCTGAATTTTGGAGAACTCAGG + Intronic
939207823 2:139130431-139130453 ATTTGGATTTTGAAGTACTAGGG - Intergenic
939535400 2:143421544-143421566 ATTTGCAATTTGAAAAACTCTGG - Intronic
940652914 2:156455036-156455058 GTCTTCTGTTTGAAGGACTAAGG + Intronic
940965400 2:159831582-159831604 ACATGTACTTTGAAGAACTATGG + Intronic
943206571 2:184905985-184906007 ACCTGATATTTGAAGAACTATGG - Intronic
945873366 2:215251471-215251493 CTCTGCAGTTTTAAGAGCTGTGG + Intergenic
946122789 2:217530985-217531007 ATAGGCAGTTTGAAGTCCTAGGG + Intronic
947278047 2:228417087-228417109 GTCTGCAAGTTGGAGAACTAAGG + Intergenic
1168782800 20:508646-508668 TTCTGCAGTTTGAAGAAAACAGG - Exonic
1168812035 20:710486-710508 AGCAGCAGTTTGAAGAATTGTGG + Intergenic
1169820272 20:9702657-9702679 ATCTGCAGTTTGGATAACAGGGG - Intronic
1173034195 20:39393133-39393155 ATCTGCAGTTTGCTCAAGTAAGG + Intergenic
1173339955 20:42144183-42144205 ATCATTAGTTTGAAGAACTGAGG + Intronic
1176965382 21:15206709-15206731 AACTGCAGTTTGAGGAACGAGGG - Intergenic
1177115178 21:17076495-17076517 ATCTGCTGTTTCAAGACATATGG + Intergenic
1177186782 21:17806341-17806363 AACTGCTCTTTAAAGAACTATGG + Intronic
1178661677 21:34511849-34511871 TTCTGCAGTTGGAAGAAGTGAGG + Intergenic
1181908793 22:26221200-26221222 AACTGCAGTTTGAAGGATGAAGG - Intronic
1182051716 22:27317440-27317462 ATCTGCTGTTTTAAGCACTTTGG + Intergenic
949491041 3:4589356-4589378 ATCTGCAGCTTGAAAAACACTGG + Intronic
951544887 3:23814820-23814842 ATCTGAAGTTTAAAGGACTTAGG - Intronic
955223964 3:57046007-57046029 TTCTGCATTTTGAAGCACTCTGG - Intronic
955418279 3:58713138-58713160 ATCTGCAAGCTGAAGAACCAGGG + Intergenic
955844417 3:63146672-63146694 ATCTGCAGACTGGAGAACCATGG - Intergenic
955878679 3:63521209-63521231 ATCTGTATTTTTAAGAACTGGGG - Intronic
956465448 3:69516256-69516278 ATCTGCAGTTTCCAGAATTAAGG - Intronic
957546199 3:81640515-81640537 ATCTGCAAGTTGAAGAGCCAGGG - Intronic
958461314 3:94399910-94399932 AGCTGCAGTGTGAAGATATAAGG + Intergenic
959373682 3:105561517-105561539 CTCTGCAGTTTGACTAACTCTGG - Intronic
959870770 3:111324995-111325017 ATGTTGATTTTGAAGAACTAAGG - Intronic
960083550 3:113566875-113566897 ATGGGCATTTTGAAGAACAAGGG - Intronic
960203326 3:114864871-114864893 ATATGCAGATTGAAGAAGTGTGG - Intronic
962663087 3:137625031-137625053 ATCTGTAGTATGAATAAATAAGG + Intergenic
964133812 3:153320769-153320791 ATCTGCAGTTTAAAGGAGGAAGG + Intergenic
964893124 3:161560359-161560381 ATTTGCGTTTTGAAGAACAAAGG + Intergenic
965534271 3:169808933-169808955 AAATGCTGTTTGGAGAACTAGGG + Intronic
966804532 3:183796490-183796512 ATCTGATGTTTGAAAAACAAAGG + Intronic
971069930 4:23079955-23079977 TTCTGTAGTTTGAAGAACAGTGG + Intergenic
973139215 4:46745202-46745224 ATCTGGAGTTTGCAGAAGCAAGG - Intronic
974417199 4:61624214-61624236 ATTTGCATTTTGAAGAGATATGG + Intronic
974719770 4:65723719-65723741 ATCTTTAGTTTGAAGAATCAAGG + Intergenic
975043456 4:69772911-69772933 ATATTATGTTTGAAGAACTATGG + Intronic
976214628 4:82704695-82704717 ATCTGAAGTTTGAAGACGCAGGG - Intronic
976633518 4:87264413-87264435 ATGTTCAGTATGAAGAAGTAAGG - Intergenic
976649621 4:87421056-87421078 TTCTGCAGTTTTCAGAACAATGG + Intergenic
976924087 4:90475546-90475568 CTCTGCAGTTGGAAGCACAAGGG + Intronic
977135636 4:93300289-93300311 ATCTGCAGATTCAATAACTATGG - Intronic
979353201 4:119670287-119670309 TTCTGCTGTTTGGAGAAGTAAGG + Intergenic
979950721 4:126890185-126890207 AACAGCAGTCTGAATAACTAAGG - Intergenic
981455534 4:144948929-144948951 ATCTCCAGTTTATAGAACAATGG - Intergenic
981537525 4:145815169-145815191 ATCTTCAGTTTGAAGCCCTTTGG + Intronic
982410605 4:155072291-155072313 ATCTGCAATCTGGAGAACTATGG + Intergenic
983210370 4:164952268-164952290 ATATGCAGTTTTACTAACTATGG + Intergenic
984409046 4:179371661-179371683 ATATGCAGTGTGCAGAACCATGG - Intergenic
984564967 4:181318529-181318551 ATCTGCAAACTGAAGAACAAGGG + Intergenic
989208774 5:38838429-38838451 ATTTCTAGTTTGAAGAACCAGGG + Intergenic
990698440 5:58449050-58449072 ATATGAATTTTGAAGAACTTTGG - Intergenic
990818158 5:59808250-59808272 ATCTGAAGTTGGAATGACTATGG - Intronic
994772505 5:104001361-104001383 ATCTGCTCTTTGAGGAACTGTGG - Intergenic
994923505 5:106083037-106083059 AGTTTCATTTTGAAGAACTAGGG - Intergenic
995473447 5:112526073-112526095 TTCTGCACTTTGACTAACTAAGG - Intergenic
996125513 5:119721637-119721659 ATCTGGACTTTGAAGAGCTGAGG + Intergenic
996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG + Intergenic
996663140 5:126027462-126027484 AGCTGCAGTATGAAGAGCGAGGG - Intergenic
998514111 5:142737276-142737298 ATCTGCAGGTTGGTGAACGATGG - Intergenic
1000414267 5:160966930-160966952 TTCTGAAATGTGAAGAACTATGG + Intergenic
1000536661 5:162486441-162486463 ATCTGAAGTTTAAAAAACAAAGG - Intergenic
1001401682 5:171450058-171450080 ATATGCAGTTTGTACAACCAGGG + Intronic
1001408102 5:171490439-171490461 ATCTGCAGTTTGTTGAACCAAGG + Intergenic
1003864496 6:10350787-10350809 TTCTGCAGTTTGGACAACTCAGG + Intergenic
1004588016 6:17021415-17021437 ACCTGTAGTTTGAAAAACAATGG - Intergenic
1005218319 6:23557213-23557235 TGTTGCAATTTGAAGAACTAAGG + Intergenic
1008010201 6:46458532-46458554 AATTGGAGTTTGAAGAACTTTGG - Intronic
1010899166 6:81404350-81404372 ATCTGCAGTTCTAGGATCTAAGG + Intergenic
1014623272 6:123695694-123695716 TTCTTCAGCTTGAAGATCTAAGG - Intergenic
1015406715 6:132845684-132845706 ATCTGCAGTCTGAAGGCCTGAGG - Intergenic
1016280076 6:142406792-142406814 AACTGCAGTTTTAAAAATTATGG + Intronic
1016573899 6:145546114-145546136 ATCTGCAAGCTGCAGAACTAGGG + Intronic
1021767717 7:23966224-23966246 ATGTGCAGTTTGAGGAATCAAGG - Intergenic
1023530994 7:41154143-41154165 ATGTGCAGTTCTAAGAACAAGGG - Intergenic
1023684378 7:42719566-42719588 CTCAGGAGTTGGAAGAACTAGGG - Intergenic
1024179148 7:46871638-46871660 ATCTGCAAATGGAAGGACTAGGG - Intergenic
1024183060 7:46916911-46916933 CTCTGCAGTCTGAAGAAATCTGG - Intergenic
1027726297 7:81810227-81810249 GTCTGCAGTTTGATGAAGTGAGG - Intergenic
1027732759 7:81896999-81897021 ATTTGCAGTTTGCAAAAATATGG - Intergenic
1028319867 7:89446682-89446704 ATTTGCAGTTGGAATAATTATGG - Intergenic
1030080495 7:105773900-105773922 ACATGCAGGCTGAAGAACTACGG - Intronic
1030608544 7:111664573-111664595 ATCTGCAATCTGGAGAACCAGGG + Intergenic
1030695237 7:112577912-112577934 ATCTGTAGCTGGAAAAACTATGG + Intergenic
1031324352 7:120374051-120374073 ATCTGCACTTTCAAAAAATATGG - Intronic
1031809639 7:126350095-126350117 ATCTGTGGTTTAAATAACTATGG - Intergenic
1032272062 7:130418306-130418328 AATTGCAGTTTGAAGAACCTAGG - Intronic
1033252245 7:139770535-139770557 ATTTGCATCTTGAAGAACAAAGG - Intronic
1034999826 7:155603833-155603855 TTCTGCATTTTGAAAAACTGTGG - Intergenic
1035722525 8:1802700-1802722 ATCTGCAGTTTTAAGTAAAATGG - Intergenic
1036943629 8:13074008-13074030 ATATGCAGTTTTAAAAACAAAGG - Intergenic
1037968266 8:23150447-23150469 ATGTGCACTTTGAAGAAGCAGGG - Intronic
1038002299 8:23402809-23402831 CTCTGCAGTTTCAAGATCTTAGG + Intronic
1038144903 8:24886426-24886448 ATCTGCAGATTGTAGAACCATGG + Intergenic
1038203530 8:25440500-25440522 ATCAGCAAATTGAAGAACAAAGG + Intronic
1038262490 8:26008607-26008629 AAGTGCAGTTAGAAGAATTAAGG + Intronic
1038281131 8:26166087-26166109 ATATGCATTTTAATGAACTAGGG - Intergenic
1040928337 8:52708869-52708891 AACTGCAGTTTACAGAACTAGGG + Intronic
1041318965 8:56594037-56594059 ATGTGGAGTTTGAAGCACCAAGG + Intergenic
1042554882 8:70025896-70025918 ATATACAGTTTGAAGAATTTTGG - Intergenic
1043371589 8:79600094-79600116 CTCTGCAGTTCAAAGACCTAAGG - Intergenic
1043582448 8:81729743-81729765 ATCTTGAGTTTGAAGTACTAGGG - Intronic
1044011527 8:86999678-86999700 CTCTGAAGTTTGAGGAAATAAGG - Intronic
1044522760 8:93218648-93218670 CTCTCCATTTTGAAGAACCATGG - Intergenic
1044625310 8:94230846-94230868 ATCTACAGTTGGCAGAGCTAAGG + Intergenic
1044644824 8:94428682-94428704 ATCTGCAGATTGAACTACTGTGG - Intronic
1045342961 8:101270646-101270668 AACTGCAGTCTGGAGAACCAGGG - Intergenic
1046588756 8:116180160-116180182 ATTTCCAGTTTGAAGAACTGTGG + Intergenic
1048063568 8:130945509-130945531 ATCTCCAGTTTACAGAGCTAGGG - Intronic
1050420930 9:5464626-5464648 CTCTGCAGTTTGAACATCTCTGG - Intronic
1051376991 9:16412123-16412145 TTCTCCACTTTGAAGAACTTTGG - Exonic
1052262226 9:26530478-26530500 AGCTGGATTTTGAATAACTAGGG + Intergenic
1052349121 9:27440204-27440226 ATCTGCAGGTTGAAGCAATGTGG + Intronic
1052407048 9:28074402-28074424 GTCTGCAGAATGAAGAACAATGG - Intronic
1056370267 9:85947043-85947065 TTCTCCAGTTTGAAGAAACATGG - Intronic
1058126297 9:101199085-101199107 TTCTGCAGTCTGAAGGAATATGG - Intronic
1058361555 9:104152869-104152891 AACTGCAGTTTGAGGACCTCTGG - Intergenic
1191036407 X:56030007-56030029 TTCTGCACTTTGACTAACTAAGG + Intergenic
1191132676 X:57031174-57031196 ATCTGCAGATTGCAAAACCATGG + Intergenic
1191886901 X:65898097-65898119 ATCTGCAAGCAGAAGAACTAGGG - Intergenic
1192958227 X:76095999-76096021 GTCTGCAGGTTGAAAAACCATGG + Intergenic
1195447125 X:104965050-104965072 ATCTGCAAACTGAAGTACTAAGG + Intronic
1195792228 X:108600758-108600780 ACCTGTAAGTTGAAGAACTAGGG + Intronic
1195820927 X:108944533-108944555 ATCTGCAGTTGCAAAAACTGTGG + Intergenic
1197680004 X:129372559-129372581 ATCTGCAGGTTGAAGAAAGGAGG + Intergenic
1197687952 X:129463509-129463531 ATCTGTAGCTTGAAGGACTGAGG - Intronic
1199854395 X:151748417-151748439 AGCTGCATTTAGATGAACTATGG + Intergenic