ID: 1132140651

View in Genome Browser
Species Human (GRCh38)
Location 15:99390833-99390855
Sequence AGCCTGGAAGCCACTAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 2, 2: 7, 3: 39, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132140644_1132140651 17 Left 1132140644 15:99390793-99390815 CCTTGAAAACCAACAGTATACAA 0: 1
1: 0
2: 9
3: 92
4: 712
Right 1132140651 15:99390833-99390855 AGCCTGGAAGCCACTAGAGGGGG 0: 1
1: 2
2: 7
3: 39
4: 234
1132140646_1132140651 8 Left 1132140646 15:99390802-99390824 CCAACAGTATACAATGAAGGTGA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 1132140651 15:99390833-99390855 AGCCTGGAAGCCACTAGAGGGGG 0: 1
1: 2
2: 7
3: 39
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132140651 Original CRISPR AGCCTGGAAGCCACTAGAGG GGG Intergenic
900119544 1:1042671-1042693 AGGCTGGAAGACACAAGAGGCGG - Intronic
900271971 1:1795251-1795273 AACCAGGAAGCCAGTGGAGGAGG - Intronic
900284358 1:1891880-1891902 AGCCTGGAAGCCAGGACATGTGG - Intergenic
902818260 1:18928219-18928241 AGCCGGGAGGCCACAAGAGGTGG - Intronic
902984956 1:20149524-20149546 AGCCTGGAAACTTCTAGAAGAGG + Exonic
905312142 1:37056687-37056709 AGCCTGGAAGCTACCAGAGAAGG + Intergenic
905629484 1:39510820-39510842 AGCCTGGAAGCTCCCAGAGGAGG + Intronic
905668276 1:39775373-39775395 AGCCTGGAAGTTCCCAGAGGAGG - Intronic
908704903 1:66942363-66942385 AGACTAGTAGCCATTAGAGGTGG + Intronic
911149309 1:94581821-94581843 ATCCAGGAAGACACTGGAGGGGG - Intergenic
911509882 1:98798589-98798611 AACATGGATGCCACTAGAGGTGG - Intergenic
913126375 1:115794063-115794085 TGCCTGGAAGACACCAGGGGAGG + Intergenic
915541926 1:156572728-156572750 AGCCTGGAAGGAACAAGACGAGG - Intergenic
916418002 1:164610503-164610525 AGCCAGGAAGGCACTGGGGGTGG + Intronic
916547221 1:165817252-165817274 AGCCTAGTAGCCAGGAGAGGAGG - Intronic
917401309 1:174652772-174652794 GGTCTGGAACCCACTTGAGGTGG + Intronic
921345265 1:214177135-214177157 AGCCTGGAAGACACGAAAAGAGG + Intergenic
922465869 1:225845377-225845399 AGCCTGGAGGGCACTTGTGGGGG - Exonic
923544507 1:234914377-234914399 GGCCTGGAAACCCCTAAAGGAGG - Intergenic
924393223 1:243586709-243586731 AAACTGGAAACTACTAGAGGAGG + Intronic
1068428615 10:56902348-56902370 AGCATGGAATTCACTAGAGGAGG + Intergenic
1069332485 10:67309483-67309505 AGCCTGGGAGACAATAGAAGAGG + Intronic
1070662072 10:78314123-78314145 AGCCTGGAAGCCAAGAGATTAGG + Intergenic
1070671147 10:78378177-78378199 CTCCTGGAGGCCACTAGAGAGGG - Intergenic
1070833745 10:79435550-79435572 AGGCTGGAGGGCACTAGAGGTGG - Intronic
1071804542 10:89102721-89102743 AGCCTAGCAGCCACTGGAGGTGG - Intergenic
1072373797 10:94793803-94793825 AGCCAGGTACCCACTTGAGGAGG + Intronic
1072840763 10:98771503-98771525 AGCCTGGTATCCAGGAGAGGAGG - Intronic
1072948158 10:99829223-99829245 AGCCTAGCAGCCACTGGAGGGGG - Intronic
1076143800 10:128100309-128100331 AGCCAGGCAGCCAGTGGAGGGGG - Intronic
1076500116 10:130930362-130930384 AGCGACGAAGCCACAAGAGGAGG - Intergenic
1076898128 10:133324417-133324439 AGCCTGGGAGCCAATGGTGGGGG + Intronic
1077511321 11:2965146-2965168 AGCCTGGAAGTCAGAAGAGAAGG + Intronic
1078540228 11:12207154-12207176 GTCCTGGAAGCCAAGAGAGGAGG - Intronic
1079386407 11:19984067-19984089 AGCCTGGAAGCCACTTGCTTTGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081762262 11:45584659-45584681 AGACTGGAAGCCACGGGAGCGGG + Intergenic
1083992346 11:66254363-66254385 AGCTTTAAAGCCACAAGAGGCGG + Intergenic
1086928059 11:92662265-92662287 AGCATAGAAGAAACTAGAGGTGG + Intronic
1088187048 11:107182185-107182207 ACCCTGGGAACTACTAGAGGGGG + Intergenic
1088851692 11:113708510-113708532 AGCCTGGCAGCTACAAGAAGGGG + Intergenic
1089616319 11:119696762-119696784 AGCCTGTAACCCAGGAGAGGTGG - Intronic
1089888532 11:121855583-121855605 GGTCAGGAAGCCACTTGAGGAGG - Intergenic
1090864948 11:130691427-130691449 ACACTGGAGACCACTAGAGGTGG - Intronic
1091495436 12:968364-968386 AACCTGGCAGCCACTAGATAAGG + Intronic
1091684524 12:2552135-2552157 AGCCTGGAAGCCGCGGGAGGAGG + Intronic
1095614509 12:44172313-44172335 TTCCTCTAAGCCACTAGAGGAGG + Intronic
1095717695 12:45365630-45365652 AGCCTAGCAGCCACTGAAGGGGG - Intronic
1096520387 12:52181538-52181560 AGGCAGGAAGCCAAGAGAGGAGG - Intronic
1099911658 12:88841146-88841168 GACCTGGAAGCCCCTAGTGGGGG - Intergenic
1100948846 12:99822449-99822471 AAACTGGAGACCACTAGAGGGGG - Intronic
1101797178 12:107985978-107986000 ACACTGTAAGCTACTAGAGGTGG + Intergenic
1103279634 12:119746110-119746132 ATCATGGAAGACACTAAAGGGGG - Intronic
1103935722 12:124475430-124475452 AGCCTGGAGGCCACTGGGGCTGG + Intronic
1104971176 12:132531274-132531296 AGCCTGGGACCCACTAGTGGGGG + Intronic
1106768390 13:32938882-32938904 AGCCTGTCAGCCAATGGAGGTGG - Intergenic
1109392725 13:61713611-61713633 AGCCTAGGAGCCACTGGAAGAGG - Intergenic
1111517753 13:89357542-89357564 ATCCTAGAAGCCAGAAGAGGAGG + Intergenic
1112462011 13:99611045-99611067 AGCATGGCAGCCACTAGAGGGGG - Intronic
1112947908 13:104955008-104955030 AGCCTGGAAGACCGTTGAGGAGG + Intergenic
1113568331 13:111334876-111334898 AGCCTGGCAGCCACTGCAGCGGG - Intronic
1114337521 14:21707238-21707260 AGCCTTGAAGCTACTAGACAGGG - Intergenic
1115265434 14:31495064-31495086 AGGCAGGGAGCCACTTGAGGAGG - Intronic
1116922850 14:50598811-50598833 AGCCTGGTAGTCAATAGAGGTGG + Intronic
1117902071 14:60544595-60544617 AACCTGGAAGACACTAAAGAGGG - Intergenic
1119100742 14:71878124-71878146 AGCCAGGGACCCACTTGAGGAGG + Intergenic
1119802482 14:77458085-77458107 CGCCTGGAAACTACTAGAAGCGG - Exonic
1121248404 14:92481555-92481577 AGGCTAGCAGCCACAAGAGGGGG - Intronic
1121435159 14:93914455-93914477 AGCCAGGAAGCCACAAGGAGAGG + Intergenic
1121655171 14:95589698-95589720 AGCCTGAAATCCACTATAGTGGG + Intergenic
1121766699 14:96493843-96493865 ACCCTGGAGACTACTAGAGGTGG - Intergenic
1123405686 15:20018329-20018351 AGCATGGAGCCCACTAGAAGTGG - Intergenic
1123515016 15:21024977-21024999 AGCATGGAGCCCACTAGAAGTGG - Intergenic
1123695823 15:22878445-22878467 AGCCCTTCAGCCACTAGAGGAGG + Intronic
1123782960 15:23645367-23645389 AGCTGGGAAGACACTTGAGGAGG + Exonic
1124127805 15:26953466-26953488 AGCCTTGTTGCCACCAGAGGGGG + Intergenic
1124147760 15:27144318-27144340 AGCCTGGTAGCCCCTGGAAGAGG + Intronic
1126844507 15:52746314-52746336 AGCCTGGCAGCCTCTGGAGGGGG + Intergenic
1128085543 15:64883954-64883976 AGCCTGGAAGCAGGGAGAGGTGG + Intronic
1128322748 15:66704195-66704217 AGCGTGGGAGCCACCAGGGGAGG + Intronic
1129120076 15:73390930-73390952 AGCCTAGATGCCTCTGGAGGGGG - Intergenic
1129191625 15:73941096-73941118 ACCCTGGAAGCCTCTGGGGGAGG - Intronic
1129609831 15:77044412-77044434 TGCCTGGGAACCACTAGAAGGGG - Exonic
1130181510 15:81634021-81634043 AGCCAGGCAGCCACCAGAGCTGG + Intergenic
1130283603 15:82538083-82538105 GTCCTGGAAGCCACTAGATTTGG + Intronic
1132140651 15:99390833-99390855 AGCCTGGAAGCCACTAGAGGGGG + Intergenic
1133206799 16:4238960-4238982 AGCCTGGAATGCACTAGACTGGG - Intronic
1134290127 16:12897915-12897937 ACCCTAAAAGCCACTTGAGGAGG + Intergenic
1135068559 16:19332486-19332508 AGCCTGGCAGCCACAAGAGTAGG - Intergenic
1135915533 16:26602336-26602358 AGCCTGGAAATCACTGGATGGGG + Intergenic
1136221902 16:28834586-28834608 GGCGTGGCAGCCACCAGAGGCGG - Exonic
1138252547 16:55513722-55513744 AACCTGTCAGCCACTAGAGGGGG + Intronic
1140378009 16:74460680-74460702 AGCCTGGCATCCAATATAGGAGG - Intronic
1142597403 17:1036261-1036283 AGCCTGGGAGCCAGTTGGGGCGG + Intronic
1143296198 17:5873851-5873873 TGAGTGGAAGCCACTAGAAGTGG + Intronic
1144103502 17:11964793-11964815 AGCCTGGAAACCACTGGAAGGGG + Intronic
1144384966 17:14740927-14740949 AGCCTCGAAAACACTAGAGTAGG + Intergenic
1147990317 17:44328693-44328715 AGCCTGGAAGGCTGCAGAGGTGG + Intergenic
1148213903 17:45824202-45824224 AGCCTGGCACACAGTAGAGGAGG + Intronic
1149405386 17:56344832-56344854 AGCCTGTCAGCCACTGGAAGGGG - Intronic
1150931080 17:69586172-69586194 ACCCTGGAAACTACTAGAGTGGG + Intergenic
1150957381 17:69874167-69874189 AGCCTAGAAACCACTAGAAGGGG + Intergenic
1152873974 17:82775213-82775235 AGCCTGGGATCCAGGAGAGGTGG + Intronic
1155338702 18:24792303-24792325 GGCCTGGAAGCCAGGAGGGGAGG - Intergenic
1156276998 18:35593218-35593240 AGTCAGGAAACCAATAGAGGAGG + Intronic
1156948137 18:42860231-42860253 AGCCTAGCAGCCACCAGAGAGGG - Intronic
1157836401 18:50907243-50907265 AGCCTGGAAGCCACCAGGGCAGG - Intronic
1158416059 18:57250724-57250746 TACCTGGAAGCATCTAGAGGAGG - Intergenic
1158569616 18:58586570-58586592 AGCCTGGCAGCAGCTGGAGGGGG + Intronic
1159560911 18:69993021-69993043 AGCCATGAAGCCACAGGAGGAGG - Intergenic
1160748232 19:721215-721237 AGCCAGGGAGCCTCTAGAGCTGG + Intronic
1161366411 19:3882153-3882175 AGCCTGGATGCCATGAGAGTTGG + Intronic
1161847696 19:6721060-6721082 AGCATGGAAGCCTCTGGAAGTGG - Intronic
1162614222 19:11784287-11784309 AGCCTGGAAGTCACTTCAGATGG + Intergenic
1162742097 19:12779157-12779179 TTCCTGGAAACCAGTAGAGGGGG - Intronic
1163535685 19:17874941-17874963 GGACTGGAAGCCAGAAGAGGTGG - Intronic
1163670780 19:18627172-18627194 AGGCCGGAAGCCCCAAGAGGAGG - Intergenic
1164731523 19:30508565-30508587 AGGCTGGAAGGCAGCAGAGGGGG + Intronic
1164989792 19:32675395-32675417 AGCCGGGCTGACACTAGAGGTGG + Exonic
1165154615 19:33779446-33779468 AGCCGGGAAGCCGGGAGAGGAGG - Intergenic
1166065543 19:40356390-40356412 AGTCTGGAAGCCAAGGGAGGTGG + Intronic
1168380815 19:55921830-55921852 ATACTGGAAGCCACCAGAGCTGG + Intronic
925825960 2:7848910-7848932 AGCTAGGAAGCCACTGGATGTGG - Intergenic
926674073 2:15604982-15605004 AGCGAGGAAGCCACTAGATCTGG + Intronic
926911367 2:17854314-17854336 ACACTGGAGGCTACTAGAGGAGG - Intergenic
928408901 2:31038597-31038619 AGCCTAGCAGCCACTAGAGGGGG - Intronic
928584877 2:32749353-32749375 GGCCTGGCAGCCACTGGAGGGGG - Intronic
932306227 2:70705743-70705765 AGCCTGGAAGCCCCAGGAGGTGG - Intronic
933734014 2:85480524-85480546 AACCTGGAAGCCAGGAGCGGTGG + Intergenic
934707707 2:96496344-96496366 AGCCTTGAAGCCACTCAGGGTGG - Intergenic
935689546 2:105718477-105718499 ACTCTGGAAACCACTAGAGACGG - Intergenic
936482418 2:112896977-112896999 AGCCAGGAAGCCAAGAGAGTAGG - Intergenic
937181937 2:120004344-120004366 AGCCTGGCAGCCCCTGGAGGAGG - Intergenic
937513631 2:122628055-122628077 AAGCTGGAAGCCAATAGAGAGGG + Intergenic
938618459 2:133023606-133023628 ACCCTGGAAACTACTAGACGTGG - Intronic
940581981 2:155592447-155592469 AGCCTGGCAGCCACTGGAGGGGG + Intergenic
941090925 2:161174703-161174725 TGCCTGAAAGCAAGTAGAGGTGG - Intronic
942921871 2:181383886-181383908 AGCATGGCAGCCACTGGAGGGGG + Intergenic
944045146 2:195402735-195402757 AGCCTGGAAGCCAATGGAAGGGG + Intergenic
945276564 2:207993422-207993444 AGCCTTGGAGCCAGTAGAGGTGG - Intronic
946400118 2:219464222-219464244 GACCTGGAAGCTCCTAGAGGTGG + Intronic
947013650 2:225593208-225593230 AGGCTGGATGTCACAAGAGGTGG + Intronic
948797908 2:240413999-240414021 AGCCTGGAGGTCCCTAGGGGGGG + Intergenic
949062235 2:241968039-241968061 AGCCTGGAAGCTGTTGGAGGAGG + Intergenic
1169022845 20:2342362-2342384 AGCCTGGAGGCCAAGAGAAGAGG - Intergenic
1169057238 20:2633684-2633706 AGCCTGGCAGTCACTGGAGGAGG - Intronic
1169393748 20:5212128-5212150 AGCCTAGAGGCCACTGGGGGAGG - Intergenic
1173742834 20:45413829-45413851 AGCCTGTAGACCACTAGAGGAGG + Intergenic
1178094873 21:29203859-29203881 AGCCTGGCAGCCACTGGAGAGGG - Intronic
1179305606 21:40151384-40151406 AGAATGGTGGCCACTAGAGGAGG - Intronic
1182501807 22:30753443-30753465 AGCCTGGGAGTCACCAGGGGAGG + Intronic
1183645445 22:39123740-39123762 AGCACCGAAGCCACTGGAGGAGG + Intronic
1184629402 22:45763904-45763926 GGCCTGGAAGACACTGGGGGAGG - Intronic
1184671196 22:46013042-46013064 GGCCAGGAAGCCCCGAGAGGAGG - Intergenic
1185033290 22:48457140-48457162 GGCCTGGAAGCAAAGAGAGGTGG - Intergenic
1185046213 22:48529864-48529886 AGCCTGGAAGGCACATGTGGAGG + Intronic
1185153094 22:49177752-49177774 GAACTGGAAGCCACTAGAGCTGG + Intergenic
949647509 3:6113477-6113499 ATCCTGGAAGCCACTGGAGGGGG + Intergenic
949812932 3:8026776-8026798 ACCCTGGCAGCCACTAGAGAAGG - Intergenic
950633395 3:14298896-14298918 AGCCTGAAATCTACAAGAGGAGG - Intergenic
953438075 3:42895705-42895727 AGCCTGGCAGCCACCAGAGGGGG - Intronic
955470306 3:59279689-59279711 AGCCCGGAAGCAAGTAGAGAAGG - Intergenic
955753172 3:62203288-62203310 GGCCTGGCTGCCACTGGAGGAGG - Exonic
957717149 3:83942744-83942766 ACCCTGGGTTCCACTAGAGGAGG - Intergenic
959012357 3:101092677-101092699 AGCCTGGAAGCCACTGGATGGGG + Intergenic
959409374 3:106001151-106001173 ACACTGGAAACTACTAGAGGAGG + Intergenic
959838183 3:110944794-110944816 AGCCTGGACTCCAGTAGAGCTGG - Intergenic
960521573 3:118661132-118661154 AGCCTGCTAGGAACTAGAGGAGG - Intergenic
960856733 3:122109126-122109148 AGCCTGAAATCCACAATAGGAGG - Intronic
961425736 3:126846094-126846116 AGCCTGCCAGCCACCAGAAGGGG + Intronic
961537900 3:127580995-127581017 AGCCTGGAAGACAGGAGAGCTGG + Intronic
962671212 3:137710594-137710616 AGCCTGGGAGCAAAAAGAGGTGG - Intergenic
963284685 3:143422578-143422600 ACACTGGAAACTACTAGAGGAGG + Intronic
964278852 3:155039251-155039273 AAAATAGAAGCCACTAGAGGAGG - Intronic
967619554 3:191616438-191616460 AGCCAAGCAGCCACTGGAGGTGG + Intergenic
970018123 4:11535507-11535529 TGCCTGCATGCCACTGGAGGGGG - Intergenic
970341416 4:15111230-15111252 AGCCCGGAAGCCAATTGAGTTGG - Intergenic
970458144 4:16246045-16246067 AGCCTGAAAGCCGCTTGAGAAGG - Intergenic
970689171 4:18602565-18602587 AGCCAGGGACCCACTTGAGGAGG + Intergenic
972074085 4:35061616-35061638 ACACTGGAAACTACTAGAGGGGG + Intergenic
973222056 4:47737819-47737841 AGCCAAGCAGCCACTAGAAGGGG + Intronic
974670657 4:65025864-65025886 AACCTGGAACCTACTAGAGAAGG - Intergenic
974684648 4:65211424-65211446 AGAGTGGAGACCACTAGAGGGGG + Intergenic
975679144 4:76858364-76858386 AGCCTAGCAGCCACTGGAGGGGG + Intergenic
978135824 4:105258013-105258035 AGCCAGGCTGCCACTAGAGGAGG - Intronic
983428973 4:167623063-167623085 GGCCTGAAAGCCACTGGAGGAGG + Intergenic
984302176 4:177935338-177935360 AGCCTAGTAGCTACCAGAGGGGG - Intronic
984789311 4:183600376-183600398 AGCTTGGCAGCCACCAGAGGGGG - Intergenic
985833967 5:2257198-2257220 AGACTGGAGGCCGCTGGAGGAGG + Intergenic
986328577 5:6700963-6700985 AGCCTGGAAGCTACCAGAGCTGG - Intergenic
987296105 5:16552919-16552941 GGGCTGGCTGCCACTAGAGGGGG - Intronic
988970860 5:36465898-36465920 AGCCAGGGACCCACTTGAGGAGG - Intergenic
991956204 5:71998043-71998065 AGCCTGTTAGCCAAGAGAGGAGG - Intergenic
993265540 5:85721987-85722009 AGTCAGGAATCCACTTGAGGAGG - Intergenic
993353137 5:86874514-86874536 AGACTGGCAGCTACTGGAGGGGG + Intergenic
996993669 5:129668104-129668126 ATGCTGGCAGCCACTAGAGTTGG - Intronic
997362660 5:133305192-133305214 AGCCTGCAAGCCGCTGGAGAGGG - Intronic
998400073 5:141844102-141844124 GGCATGGAAGCCACTAGACTCGG + Intergenic
999311714 5:150555735-150555757 AGCATGGAAGGCAGGAGAGGTGG + Exonic
1000259396 5:159572183-159572205 AACCTGGCAGCCACTGGAAGGGG - Intergenic
1000263753 5:159615325-159615347 AGGTTGGTAGCCTCTAGAGGCGG - Intergenic
1000530691 5:162416006-162416028 AGCCTGGGAGTCCCTAGAGGGGG + Intergenic
1001110946 5:168895873-168895895 AGCCTGAAAGGCACTAGACAAGG + Intronic
1002174402 5:177393423-177393445 AGACAGGAAGCCACTGGATGTGG + Intronic
1004612377 6:17255794-17255816 AGCCCGGCAGTCACTGGAGGGGG - Intergenic
1004976252 6:20970202-20970224 AGCCTGGAAGCCACTTGAGGGGG - Intronic
1006609770 6:35287325-35287347 TGCCTGGAGGGAACTAGAGGGGG + Intronic
1007237482 6:40401220-40401242 AGACTGGAAGCCATGAGAGAGGG - Intronic
1009777008 6:68218101-68218123 GGCCAGGAACCCACTTGAGGAGG + Intergenic
1011214211 6:84987688-84987710 AGCCTGGATGCTCCTATAGGAGG - Intergenic
1011846383 6:91568097-91568119 ACACTGGAAGCTACTAGAGAAGG + Intergenic
1016933171 6:149428802-149428824 AGCTTGGCAGCCAGGAGAGGAGG + Intergenic
1018034250 6:159867792-159867814 ATGCTGGAAGCCACCAGAAGTGG + Intergenic
1019408500 7:896499-896521 TGCCTGGGAGCCCCCAGAGGAGG + Intergenic
1019481839 7:1270487-1270509 AGCCCGGATGCCACTGGAGTGGG - Intergenic
1019504808 7:1385530-1385552 AGGCTGGAAGCCAGTGAAGGGGG + Intergenic
1020550739 7:9601160-9601182 ACACTGGAGACCACTAGAGGGGG + Intergenic
1020874210 7:13673495-13673517 AGTCAGGGAGCCACTTGAGGAGG + Intergenic
1021138634 7:16995965-16995987 ACACTGGAAACTACTAGAGGAGG - Intergenic
1021475811 7:21059354-21059376 AGCCTAGGAGCCACAGGAGGGGG - Intergenic
1021516717 7:21497280-21497302 CATCTGGCAGCCACTAGAGGGGG - Intronic
1022425722 7:30267006-30267028 AGCCTGGCAGCCACTGGAGGAGG - Intergenic
1023342264 7:39233855-39233877 AGCCCGGAAAACACAAGAGGAGG - Intronic
1023986724 7:45101370-45101392 AGCCTGGAAGGAAGAAGAGGTGG + Exonic
1024349544 7:48349642-48349664 AGCAGGGAAACCAGTAGAGGAGG + Intronic
1024499253 7:50085510-50085532 AGCCTGGCAGCCAATGAAGGGGG + Intronic
1024621330 7:51159832-51159854 AACCTGGAACCCATCAGAGGAGG - Intronic
1026022187 7:66717584-66717606 AGCCTGGGTGACACTAGAGACGG - Intronic
1026131819 7:67627246-67627268 AGCCTGGAAGCTACCTGAGAGGG + Intergenic
1026910150 7:74086858-74086880 AGCCTGGAAGACACTGAGGGTGG - Intronic
1027848572 7:83419055-83419077 AGACTGGAGACCACTGGAGGGGG - Intronic
1029114560 7:98230655-98230677 AGCCTGGAAGCCCCCTGGGGTGG + Intronic
1029447301 7:100620956-100620978 CTCCTGGAAGCCAGTGGAGGAGG + Exonic
1032276354 7:130459546-130459568 AGCCCGGCAGCCACCAGAGAGGG - Intergenic
1032475602 7:132209529-132209551 AGCCTGGCAGCCAGGGGAGGAGG + Intronic
1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG + Intronic
1035104140 7:156428207-156428229 TGGCTGGAAGCCACTATAGATGG + Intergenic
1035485148 7:159217590-159217612 AGCCTCCCAGCCACTAGAAGGGG + Intergenic
1035646942 8:1231788-1231810 ACCCTGGGGGCCGCTAGAGGAGG + Intergenic
1038658500 8:29475919-29475941 CACCTGGAAGCCACTACAGTGGG + Intergenic
1039466614 8:37789225-37789247 AGCCTGGGAGCTACCAGGGGAGG + Intronic
1039487717 8:37924722-37924744 AGCCTGGCAGCCACTAGAGGGGG - Intergenic
1040035356 8:42864623-42864645 AGCATCGAAGCCACCTGAGGAGG - Intronic
1041187199 8:55313555-55313577 ACTCTGGAAGCCACTAGATGGGG + Intronic
1041656404 8:60355103-60355125 AGCCTGGCAGCTACAAGAGGAGG + Intergenic
1042362091 8:67894627-67894649 AGTCAGGAACCCACTTGAGGAGG - Intergenic
1042797287 8:72678324-72678346 AACATGGAAGCCACTGCAGGTGG - Intronic
1048540349 8:135336074-135336096 AGTCTGGGACCCACTTGAGGAGG - Intergenic
1048598769 8:135896056-135896078 AGCCCTGATTCCACTAGAGGAGG - Intergenic
1048863329 8:138740124-138740146 CCCCTGGAAGCAACTGGAGGGGG - Intronic
1049244942 8:141557405-141557427 ACCCAGGAAGCCACCAGCGGAGG - Intergenic
1049721327 8:144116847-144116869 AGCCTGAAAGTCCCTAGGGGAGG + Exonic
1051917501 9:22225773-22225795 GGCCAGGAACCCACTTGAGGAGG + Intergenic
1051966867 9:22838548-22838570 AACCTAGAAGCCACTTGATGGGG - Intergenic
1052061944 9:23970808-23970830 AGCCTAGTAGCCATTAGAGAAGG - Intergenic
1052749836 9:32478489-32478511 AGCCTGGAATTCACTACAGTGGG + Intronic
1055351648 9:75394964-75394986 AGCCTGGGAGCCCCATGAGGTGG + Intergenic
1060025279 9:120165560-120165582 AGCCTGGAATCTCCTTGAGGTGG + Intergenic
1060281392 9:122218159-122218181 AGACTGGAAGCCCCTCCAGGAGG + Intronic
1061447785 9:130651049-130651071 AGCCTGGAAGGGGCTGGAGGGGG - Intergenic
1062059362 9:134486660-134486682 AGCCTCGAAGCCGCTCGTGGTGG + Intergenic
1062732365 9:138117334-138117356 AGGGAGGAAGCCCCTAGAGGAGG + Intronic
1186806675 X:13146681-13146703 AGCAAGGAAGCCAGTAGAGCAGG - Intergenic
1188156180 X:26745991-26746013 AGTATGAAAGCAACTAGAGGAGG + Intergenic
1188672463 X:32896367-32896389 AGCCTTGAAGTCACCAGGGGTGG - Intronic
1191024330 X:55897052-55897074 GGTCTGGGAGCCACTTGAGGAGG - Intergenic
1191888979 X:65921053-65921075 AGCATGGAAGCCACAGAAGGTGG - Intergenic
1192104792 X:68304791-68304813 AGCTTAGCAGCCACTAGAGAAGG + Intronic
1192845025 X:74897674-74897696 AGTCTGGAGAACACTAGAGGGGG + Intronic
1193191460 X:78575814-78575836 AGCCTGGCAGCCACTAGAAATGG + Intergenic
1193340018 X:80336409-80336431 AGCCTGGAAACCACTTCAGTAGG + Intronic
1193389227 X:80906771-80906793 AGTCAGGGAGCCACTTGAGGAGG - Intergenic
1193394534 X:80968268-80968290 GGTCGGGAAGCCACTTGAGGAGG - Intergenic
1193509505 X:82382489-82382511 TGCATGGAAGCCACCAGTGGTGG + Intergenic
1193899895 X:87164388-87164410 AGCCTAGCAGCCAGGAGAGGAGG + Intergenic
1194052742 X:89091846-89091868 AGCATAGCAGCCACAAGAGGAGG - Intergenic
1194998232 X:100615124-100615146 AGCTTTACAGCCACTAGAGGGGG + Intergenic
1196137916 X:112229972-112229994 AGCCAGGGACCCACTTGAGGAGG + Intergenic
1196358009 X:114817665-114817687 AGCCTGGCAGCTACTGGATGGGG + Intronic
1196757142 X:119167836-119167858 AGTCTGGGAGCCAGGAGAGGTGG + Intergenic
1196896062 X:120337290-120337312 AGCTTGTAAGTCACTAGAGGAGG - Intergenic
1200803374 Y:7407351-7407373 AGTCTGGGACCCACTTGAGGAGG - Intergenic
1201900550 Y:19043275-19043297 ACCCTGGAAGCGAGGAGAGGCGG + Intergenic