ID: 1132141974

View in Genome Browser
Species Human (GRCh38)
Location 15:99404196-99404218
Sequence CTGTCTATGAAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132141969_1132141974 -4 Left 1132141969 15:99404177-99404199 CCAGCAACCGATTCCTTTGCTGT No data
Right 1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG No data
1132141967_1132141974 11 Left 1132141967 15:99404162-99404184 CCTCCTATCTAGCTGCCAGCAAC No data
Right 1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG No data
1132141966_1132141974 12 Left 1132141966 15:99404161-99404183 CCCTCCTATCTAGCTGCCAGCAA No data
Right 1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG No data
1132141965_1132141974 13 Left 1132141965 15:99404160-99404182 CCCCTCCTATCTAGCTGCCAGCA No data
Right 1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG No data
1132141968_1132141974 8 Left 1132141968 15:99404165-99404187 CCTATCTAGCTGCCAGCAACCGA No data
Right 1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132141974 Original CRISPR CTGTCTATGAAGAAGGAGCA GGG Intergenic
No off target data available for this crispr