ID: 1132143805

View in Genome Browser
Species Human (GRCh38)
Location 15:99415106-99415128
Sequence GTGGCTACTCTGTTCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132143805_1132143813 8 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143813 15:99415137-99415159 AGGCAGCCCCCAGCCAGGGACGG No data
1132143805_1132143819 19 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143819 15:99415148-99415170 AGCCAGGGACGGATCAGCTTGGG No data
1132143805_1132143811 4 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143811 15:99415133-99415155 CCCAAGGCAGCCCCCAGCCAGGG No data
1132143805_1132143809 3 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143809 15:99415132-99415154 ACCCAAGGCAGCCCCCAGCCAGG No data
1132143805_1132143818 18 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143818 15:99415147-99415169 CAGCCAGGGACGGATCAGCTTGG No data
1132143805_1132143820 20 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143820 15:99415149-99415171 GCCAGGGACGGATCAGCTTGGGG No data
1132143805_1132143822 21 Left 1132143805 15:99415106-99415128 CCTTGGTAGAACAGAGTAGCCAC No data
Right 1132143822 15:99415150-99415172 CCAGGGACGGATCAGCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132143805 Original CRISPR GTGGCTACTCTGTTCTACCA AGG (reversed) Intergenic
No off target data available for this crispr