ID: 1132149073

View in Genome Browser
Species Human (GRCh38)
Location 15:99447094-99447116
Sequence CGCCTGGGGCGCACACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132149064_1132149073 -5 Left 1132149064 15:99447076-99447098 CCTTCCCCGCTGCCTGCGCGCCT No data
Right 1132149073 15:99447094-99447116 CGCCTGGGGCGCACACACCTGGG No data
1132149067_1132149073 -9 Left 1132149067 15:99447080-99447102 CCCCGCTGCCTGCGCGCCTGGGG No data
Right 1132149073 15:99447094-99447116 CGCCTGGGGCGCACACACCTGGG No data
1132149069_1132149073 -10 Left 1132149069 15:99447081-99447103 CCCGCTGCCTGCGCGCCTGGGGC No data
Right 1132149073 15:99447094-99447116 CGCCTGGGGCGCACACACCTGGG No data
1132149063_1132149073 16 Left 1132149063 15:99447055-99447077 CCTTTTACAAGTGGCGCTCGGCC No data
Right 1132149073 15:99447094-99447116 CGCCTGGGGCGCACACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132149073 Original CRISPR CGCCTGGGGCGCACACACCT GGG Intergenic
No off target data available for this crispr