ID: 1132150601

View in Genome Browser
Species Human (GRCh38)
Location 15:99455459-99455481
Sequence TGCCAGGTATGAAACCGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132150592_1132150601 4 Left 1132150592 15:99455432-99455454 CCAACCCACCAGTGGGGAGTGAG No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150591_1132150601 5 Left 1132150591 15:99455431-99455453 CCCAACCCACCAGTGGGGAGTGA No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150586_1132150601 23 Left 1132150586 15:99455413-99455435 CCCGTGGGGGAGAACACACCCAA No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150596_1132150601 -4 Left 1132150596 15:99455440-99455462 CCAGTGGGGAGTGAGGCCTTGCC No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150587_1132150601 22 Left 1132150587 15:99455414-99455436 CCGTGGGGGAGAACACACCCAAC No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150594_1132150601 0 Left 1132150594 15:99455436-99455458 CCCACCAGTGGGGAGTGAGGCCT No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data
1132150595_1132150601 -1 Left 1132150595 15:99455437-99455459 CCACCAGTGGGGAGTGAGGCCTT No data
Right 1132150601 15:99455459-99455481 TGCCAGGTATGAAACCGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132150601 Original CRISPR TGCCAGGTATGAAACCGTTG GGG Intergenic
No off target data available for this crispr