ID: 1132154354

View in Genome Browser
Species Human (GRCh38)
Location 15:99485352-99485374
Sequence GATATTCCCAGGATGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132154354_1132154365 9 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154365 15:99485384-99485406 CTAGGGGCTGCCTGCATCCCTGG No data
1132154354_1132154359 -9 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154359 15:99485366-99485388 GGGAATATCCCACAGCCTCTAGG No data
1132154354_1132154367 11 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154367 15:99485386-99485408 AGGGGCTGCCTGCATCCCTGGGG No data
1132154354_1132154360 -8 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154360 15:99485367-99485389 GGAATATCCCACAGCCTCTAGGG No data
1132154354_1132154361 -7 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154361 15:99485368-99485390 GAATATCCCACAGCCTCTAGGGG No data
1132154354_1132154371 28 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154354_1132154366 10 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154366 15:99485385-99485407 TAGGGGCTGCCTGCATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132154354 Original CRISPR GATATTCCCAGGATGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr