ID: 1132154358

View in Genome Browser
Species Human (GRCh38)
Location 15:99485363-99485385
Sequence AGAGGCTGTGGGATATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132154358_1132154373 28 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154373 15:99485414-99485436 GAGTGTCCATGGTGGACCTGAGG No data
1132154358_1132154366 -1 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154366 15:99485385-99485407 TAGGGGCTGCCTGCATCCCTGGG No data
1132154358_1132154365 -2 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154365 15:99485384-99485406 CTAGGGGCTGCCTGCATCCCTGG No data
1132154358_1132154367 0 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154367 15:99485386-99485408 AGGGGCTGCCTGCATCCCTGGGG No data
1132154358_1132154372 20 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154372 15:99485406-99485428 GGGACTCAGAGTGTCCATGGTGG No data
1132154358_1132154371 17 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132154358 Original CRISPR AGAGGCTGTGGGATATTCCC AGG (reversed) Intergenic
No off target data available for this crispr