ID: 1132154362

View in Genome Browser
Species Human (GRCh38)
Location 15:99485374-99485396
Sequence AGGCAGCCCCTAGAGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132154362_1132154371 6 Left 1132154362 15:99485374-99485396 CCCACAGCCTCTAGGGGCTGCCT No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154362_1132154372 9 Left 1132154362 15:99485374-99485396 CCCACAGCCTCTAGGGGCTGCCT No data
Right 1132154372 15:99485406-99485428 GGGACTCAGAGTGTCCATGGTGG No data
1132154362_1132154373 17 Left 1132154362 15:99485374-99485396 CCCACAGCCTCTAGGGGCTGCCT No data
Right 1132154373 15:99485414-99485436 GAGTGTCCATGGTGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132154362 Original CRISPR AGGCAGCCCCTAGAGGCTGT GGG (reversed) Intergenic
No off target data available for this crispr