ID: 1132154363 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:99485375-99485397 |
Sequence | CAGGCAGCCCCTAGAGGCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1132154363_1132154371 | 5 | Left | 1132154363 | 15:99485375-99485397 | CCACAGCCTCTAGGGGCTGCCTG | No data | ||
Right | 1132154371 | 15:99485403-99485425 | CTGGGGACTCAGAGTGTCCATGG | No data | ||||
1132154363_1132154372 | 8 | Left | 1132154363 | 15:99485375-99485397 | CCACAGCCTCTAGGGGCTGCCTG | No data | ||
Right | 1132154372 | 15:99485406-99485428 | GGGACTCAGAGTGTCCATGGTGG | No data | ||||
1132154363_1132154373 | 16 | Left | 1132154363 | 15:99485375-99485397 | CCACAGCCTCTAGGGGCTGCCTG | No data | ||
Right | 1132154373 | 15:99485414-99485436 | GAGTGTCCATGGTGGACCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1132154363 | Original CRISPR | CAGGCAGCCCCTAGAGGCTG TGG (reversed) | Intergenic | ||
No off target data available for this crispr |