ID: 1132154363

View in Genome Browser
Species Human (GRCh38)
Location 15:99485375-99485397
Sequence CAGGCAGCCCCTAGAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132154363_1132154371 5 Left 1132154363 15:99485375-99485397 CCACAGCCTCTAGGGGCTGCCTG No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154363_1132154372 8 Left 1132154363 15:99485375-99485397 CCACAGCCTCTAGGGGCTGCCTG No data
Right 1132154372 15:99485406-99485428 GGGACTCAGAGTGTCCATGGTGG No data
1132154363_1132154373 16 Left 1132154363 15:99485375-99485397 CCACAGCCTCTAGGGGCTGCCTG No data
Right 1132154373 15:99485414-99485436 GAGTGTCCATGGTGGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132154363 Original CRISPR CAGGCAGCCCCTAGAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr