ID: 1132154371

View in Genome Browser
Species Human (GRCh38)
Location 15:99485403-99485425
Sequence CTGGGGACTCAGAGTGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132154355_1132154371 25 Left 1132154355 15:99485355-99485377 CCCCTCATCCTGGGAATATCCCA No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154362_1132154371 6 Left 1132154362 15:99485374-99485396 CCCACAGCCTCTAGGGGCTGCCT No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154363_1132154371 5 Left 1132154363 15:99485375-99485397 CCACAGCCTCTAGGGGCTGCCTG No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154356_1132154371 24 Left 1132154356 15:99485356-99485378 CCCTCATCCTGGGAATATCCCAC No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154358_1132154371 17 Left 1132154358 15:99485363-99485385 CCTGGGAATATCCCACAGCCTCT No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154357_1132154371 23 Left 1132154357 15:99485357-99485379 CCTCATCCTGGGAATATCCCACA No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154354_1132154371 28 Left 1132154354 15:99485352-99485374 CCACCCCTCATCCTGGGAATATC No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data
1132154364_1132154371 -1 Left 1132154364 15:99485381-99485403 CCTCTAGGGGCTGCCTGCATCCC No data
Right 1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132154371 Original CRISPR CTGGGGACTCAGAGTGTCCA TGG Intergenic
No off target data available for this crispr