ID: 1132156133

View in Genome Browser
Species Human (GRCh38)
Location 15:99496361-99496383
Sequence GTGTGGGCAGGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132156117_1132156133 23 Left 1132156117 15:99496315-99496337 CCGGAGGTGACTCTAGTGCAGTT No data
Right 1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG No data
1132156126_1132156133 -4 Left 1132156126 15:99496342-99496364 CCACGGGGGGAGGACGAGGGTGT No data
Right 1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132156133 Original CRISPR GTGTGGGCAGGGAGGGCAGA AGG Intergenic
No off target data available for this crispr