ID: 1132157311

View in Genome Browser
Species Human (GRCh38)
Location 15:99504687-99504709
Sequence GAAACACTCGTGGCCAGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132157306_1132157311 1 Left 1132157306 15:99504663-99504685 CCATAGGACTAAAGACCCTACGC No data
Right 1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG No data
1132157304_1132157311 14 Left 1132157304 15:99504650-99504672 CCCATCAAGGTGTCCATAGGACT No data
Right 1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG No data
1132157305_1132157311 13 Left 1132157305 15:99504651-99504673 CCATCAAGGTGTCCATAGGACTA No data
Right 1132157311 15:99504687-99504709 GAAACACTCGTGGCCAGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132157311 Original CRISPR GAAACACTCGTGGCCAGGAC CGG Intergenic
No off target data available for this crispr