ID: 1132160776

View in Genome Browser
Species Human (GRCh38)
Location 15:99539813-99539835
Sequence AAAAAGCAAAAATATCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132160772_1132160776 14 Left 1132160772 15:99539776-99539798 CCTCTAAAAGTAAAACTACAAGG No data
Right 1132160776 15:99539813-99539835 AAAAAGCAAAAATATCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132160776 Original CRISPR AAAAAGCAAAAATATCGGCC GGG Intergenic
No off target data available for this crispr