ID: 1132171600

View in Genome Browser
Species Human (GRCh38)
Location 15:99662879-99662901
Sequence CATAGCAATGAGATTTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132171598_1132171600 12 Left 1132171598 15:99662844-99662866 CCGGTGTTTATGGAGCATGTACT 0: 1
1: 0
2: 5
3: 42
4: 284
Right 1132171600 15:99662879-99662901 CATAGCAATGAGATTTAAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132171600 Original CRISPR CATAGCAATGAGATTTAAGG TGG Intronic
902707602 1:18216458-18216480 AATATCATTGAGATTTTAGGGGG + Intronic
905255611 1:36680681-36680703 CAGAGCAATAAGATTAATGGTGG + Intergenic
905727926 1:40270484-40270506 AAGAGAAATGAGATTTAAGAGGG + Intronic
907766911 1:57422143-57422165 CATATCAATTAAATTAAAGGTGG - Intronic
908088321 1:60660456-60660478 CATAGAAAAGAGATTGAAGATGG + Intergenic
910216183 1:84847442-84847464 CATAGAAATGTGGTTTCAGGAGG - Intronic
912520822 1:110243531-110243553 CCTGGGAATGAGATTAAAGGAGG + Intronic
915375821 1:155394528-155394550 GATAGCAATGAGATTTGGAGAGG + Intronic
916483150 1:165233528-165233550 CATAGATCTGGGATTTAAGGGGG - Intronic
917312861 1:173694825-173694847 CATAACCATGGAATTTAAGGAGG + Intergenic
917452868 1:175161763-175161785 CACAGGAATGTGATATAAGGAGG - Intronic
918348178 1:183625097-183625119 AAAAGCACTGAGATTAAAGGAGG + Intronic
919528628 1:198686596-198686618 CATAGCAATGGAAATTAAGAGGG - Intronic
919538926 1:198825134-198825156 TAGAGTAATGAGATTTAAAGTGG - Intergenic
921478947 1:215641910-215641932 AAAAGCATTGAGATTTAAAGAGG - Intronic
923680255 1:236112948-236112970 CAGAGCAGTGGGATTTAAGCAGG + Intergenic
924371633 1:243357066-243357088 CATAGCAATGGAATTTATGAAGG + Intronic
1063271296 10:4513085-4513107 CATTACCATGACATTTAAGGAGG + Intergenic
1064667938 10:17676328-17676350 CAAAGAAAGGAGATTTAAGATGG - Intronic
1065521327 10:26576020-26576042 CATATCAATGAGATTTGGAGGGG + Intergenic
1065559692 10:26950062-26950084 CATATCAATGAGATTTGGAGGGG - Intergenic
1070230964 10:74566956-74566978 CATAAAAATGAGTTTTTAGGAGG - Intronic
1071475759 10:86023764-86023786 GAGACCAATGAGATATAAGGCGG - Intronic
1071711874 10:88057865-88057887 CAGACCAATGAGATGTAAGAGGG + Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077788058 11:5406168-5406190 TATAGCAATAATATTTAAGAAGG - Intronic
1078308688 11:10217139-10217161 CATAGCAAACAGATATCAGGAGG + Intronic
1079560941 11:21818703-21818725 CATAGAAATTAGTTTTAAGAAGG + Intergenic
1081984468 11:47291518-47291540 CATGGCAATGAGATGTCAGCTGG - Intronic
1085726175 11:78956466-78956488 TATAGAAATGAGAGTTCAGGAGG - Intronic
1086282876 11:85210951-85210973 TATAAGAATGAGATTTAAAGGGG - Intronic
1088059623 11:105631184-105631206 CATTGCACTGAGATTTTCGGTGG - Intronic
1088069197 11:105760403-105760425 CATAGAAGTTGGATTTAAGGAGG - Intronic
1088689452 11:112312889-112312911 CATAGTAATGTGGGTTAAGGTGG + Intergenic
1088750941 11:112841723-112841745 CATAGCAAGGGGGTGTAAGGTGG - Intergenic
1089881826 11:121781325-121781347 CAAAGCACTGAGATTACAGGTGG + Intergenic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1092584473 12:9882855-9882877 CAAAGTATTGAGATTTAAGAAGG - Intronic
1095626794 12:44324318-44324340 CATAGTAATGATATTGAAGATGG - Intronic
1095724621 12:45437938-45437960 CATAGCATTTACATTTAAGTTGG + Intronic
1095907534 12:47393199-47393221 CAAAGCAATGAGACTGAAAGAGG + Intergenic
1098481245 12:70964242-70964264 CATTGCAATGAGATCCAAGCAGG + Intergenic
1098992518 12:77079331-77079353 TACAGCAATGAGATTAAAGGGGG - Intergenic
1099792481 12:87353330-87353352 CATAAAAGTGAGATTTAAGTTGG + Intergenic
1103374441 12:120444773-120444795 CATAGCCATCAGATTTGATGAGG - Exonic
1104615235 12:130262447-130262469 CATAGAAATGACATTTAAACTGG + Intergenic
1107664744 13:42677311-42677333 CGCATCAAGGAGATTTAAGGAGG - Intergenic
1108472194 13:50778467-50778489 CATAGCTATGAGAAATCAGGTGG + Intronic
1109281110 13:60356687-60356709 GCTAGCAATGACATATAAGGGGG + Intergenic
1111105376 13:83638726-83638748 CTGAGAAATGAGAATTAAGGTGG - Intergenic
1111187018 13:84750956-84750978 CATAGACATGAGATTTGAGTAGG - Intergenic
1112713685 13:102159322-102159344 CATAGCATTGACATTTTAGTTGG + Intronic
1114298171 14:21349368-21349390 TATAGTAATTATATTTAAGGAGG - Intronic
1115679554 14:35721010-35721032 CACTGCAATGAGAAATAAGGAGG - Intronic
1117836820 14:59816523-59816545 CATAGAAATGAGTTTTGAGATGG + Intronic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1120215249 14:81675166-81675188 CATATCAATCAAATTCAAGGGGG - Intergenic
1130236440 15:82139237-82139259 CATGGCAATGATAATTAAGATGG + Intronic
1130323036 15:82855871-82855893 CCTAGCAAGGAAATTGAAGGAGG - Intronic
1131876939 15:96817990-96818012 AATAACAATGAGATGTAAGGAGG - Intergenic
1131923143 15:97352458-97352480 TATAGCCATAAGATTTTAGGGGG + Intergenic
1132171600 15:99662879-99662901 CATAGCAATGAGATTTAAGGTGG + Intronic
1135074990 16:19385369-19385391 TTTAGCAATGTGATTTATGGTGG + Intergenic
1137232892 16:46584580-46584602 CATAGAAATGATTTTTAAGTTGG - Intronic
1140052403 16:71493768-71493790 GAAAGCAATGACATTTTAGGAGG + Intronic
1140556734 16:75930059-75930081 CATCACATTGAGATGTAAGGGGG - Intergenic
1140661209 16:77192607-77192629 GATACCAATGAGATTGAAGGTGG + Intronic
1151077377 17:71288970-71288992 CATGGGAATGAGACTAAAGGTGG - Intergenic
1154082587 18:11273104-11273126 GCTAGCAAAGAGATTTAAGCAGG + Intergenic
1155719282 18:28991089-28991111 AATACCATTGAGATTTAAGGAGG - Intergenic
1156683962 18:39621958-39621980 TATACCAATGAGATTTACAGAGG + Intergenic
1156929879 18:42628815-42628837 CATAGCAAACAGATTGAAGATGG + Intergenic
1156952869 18:42924687-42924709 CAAAGCAATAAAATTTTAGGTGG + Intronic
1157209728 18:45731581-45731603 CATAGCAACAAGATATAACGGGG - Intronic
1157765483 18:50293672-50293694 GATAGCAATGTGATTTGTGGTGG + Intergenic
1159442969 18:68505656-68505678 TATAGCAATGGGCTTTGAGGAGG - Intergenic
1161901320 19:7121727-7121749 CAAAGCACTGAGATTACAGGCGG + Intronic
1162110926 19:8399347-8399369 CAAAGCATTGAGATTACAGGCGG + Intronic
1164549097 19:29193312-29193334 CATAGCAGTGTGAGGTAAGGAGG - Intergenic
1164606831 19:29605641-29605663 CATAGCAATAAGATCAAAGGTGG - Exonic
1164765626 19:30764665-30764687 CATAGCATTGGCATTTATGGAGG - Intergenic
1164808098 19:31133201-31133223 CATGAGAATGAGCTTTAAGGAGG - Intergenic
1164989127 19:32672112-32672134 CATCGCAGTGAGATTTCAGCAGG - Intronic
1166590605 19:43994874-43994896 ATAAGCAATGTGATTTAAGGTGG - Intronic
1167828525 19:51997724-51997746 GCTAGCAATGTGATTTATGGTGG + Intronic
927611139 2:24541903-24541925 CAGTGCAGTGAGATTTAAGAGGG + Intronic
932261722 2:70332704-70332726 CAGAGGAATGAGCTTTAATGGGG + Intergenic
933308564 2:80632349-80632371 AATGGCAACCAGATTTAAGGTGG + Intronic
933879452 2:86654856-86654878 CTTGGCAAACAGATTTAAGGAGG - Intronic
937589686 2:123598167-123598189 CTTAGCAATGTGATGTAATGTGG + Intergenic
939110475 2:138000724-138000746 CATAGTAATGTGACTCAAGGAGG - Intronic
943218843 2:185076877-185076899 CCCAGGAATGAGATTGAAGGGGG + Intergenic
943795691 2:191990019-191990041 AATAGTAATGAGGATTAAGGAGG - Intronic
944509941 2:200454612-200454634 CAAAGCAATAAGGTGTAAGGAGG - Intronic
947112134 2:226730034-226730056 CAAAGCACTGAGATTATAGGCGG + Intergenic
948509268 2:238452531-238452553 CATATCAATGGGATTTCAGGAGG - Intergenic
1178824027 21:36000393-36000415 CATCGCAGTGGGATTTAAGGAGG - Intronic
1182987725 22:34736717-34736739 CATATCAATTACATTTATGGTGG + Intergenic
1184370315 22:44077705-44077727 CTTAGCAATGATATTGGAGGGGG + Intronic
951915371 3:27795466-27795488 CATAGCAAACAGATTCAGGGTGG - Intergenic
955018419 3:55094674-55094696 CAGAGAATTGAGAATTAAGGCGG - Intergenic
955971735 3:64444363-64444385 CTTACAAGTGAGATTTAAGGCGG + Intronic
956421175 3:69087270-69087292 CAAAGCACTGAGATTGCAGGCGG + Intronic
956903735 3:73744042-73744064 CATGCCACTGAGATTTCAGGTGG - Intergenic
958533572 3:95366243-95366265 CCTAACAATGTGATTTAGGGTGG + Intergenic
959072500 3:101715924-101715946 GAAACCAATGAGATTTCAGGAGG + Intergenic
960479302 3:118169758-118169780 CATTCCAATGAGATCTGAGGTGG + Intergenic
961354779 3:126330303-126330325 CAGAGCACTGAGCTTTGAGGTGG + Intergenic
963551178 3:146725614-146725636 CATAGCAATGAGATGTTAATTGG + Intergenic
963765955 3:149336156-149336178 CATAGCAATGGGCTTGGAGGTGG + Intergenic
964365050 3:155941577-155941599 CATATCAATGAGATTTCTGGAGG - Exonic
966021638 3:175219352-175219374 AATGGCAAAAAGATTTAAGGTGG - Intronic
966511289 3:180766235-180766257 CTTAACAATGAGGTTTAAAGAGG - Intronic
966997219 3:185294989-185295011 AAAAGCAATGAGATTAGAGGGGG - Intronic
967525776 3:190491113-190491135 CATAGCAACTAACTTTAAGGAGG - Intergenic
971208083 4:24589421-24589443 AACAGAAATGAGATTTAAGTGGG + Intergenic
971756245 4:30712200-30712222 CAAAGAAATGTGATTCAAGGAGG + Intergenic
971832657 4:31717170-31717192 CATACCAAAGATAATTAAGGGGG + Intergenic
972206996 4:36785740-36785762 CAAGCCAATGAGTTTTAAGGAGG + Intergenic
973614996 4:52669593-52669615 CATAGAAATGAGACTTAGAGAGG + Intergenic
975677883 4:76845678-76845700 CATAGCAATAAGGTTTACTGGGG + Intergenic
976308912 4:83590476-83590498 AATAGCCATGATATTTAAGATGG + Intronic
976960524 4:90966142-90966164 CATACACATGAGATTTAAGAAGG + Intronic
977442471 4:97086267-97086289 GATTGCAATGAGAGTTAATGAGG + Intergenic
978350354 4:107814670-107814692 CATAGAAATTTTATTTAAGGGGG + Intergenic
983837838 4:172414747-172414769 CAAAGCACTCAGATTTAAGTAGG + Intronic
984629590 4:182046976-182046998 CACTGCAATAAGATTTAGGGAGG + Intergenic
984660484 4:182369031-182369053 GATAGTAATGACATTTAATGTGG - Intronic
985199031 4:187464938-187464960 CAAAGGAAAGAGATTTAAGGAGG + Intergenic
985878713 5:2620488-2620510 CTTTGCAATGAGCTTTGAGGCGG - Intergenic
986568336 5:9138161-9138183 CATATCAAGGAGTTTTAATGAGG - Intronic
988995170 5:36708065-36708087 CATATAAATGGGATTTATGGTGG - Intergenic
989166001 5:38434082-38434104 AAAAGCAATGAGACTTAAGCAGG - Intronic
989204093 5:38794440-38794462 CATAGCAAGAAGATATAAAGGGG + Intergenic
989768183 5:45111176-45111198 CAAAGCAATGTGATCTAAAGAGG - Intergenic
990170900 5:53048562-53048584 TATAAAAATGAGACTTAAGGAGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999291671 5:150429963-150429985 CGTAGCACACAGATTTAAGGGGG + Intergenic
999576556 5:152984656-152984678 CATGGATATGAGATTTATGGTGG - Intergenic
999721878 5:154404480-154404502 CATTGCCAGGAGAATTAAGGAGG + Intronic
1000851340 5:166343588-166343610 TGTAGCAAAGAGATTTTAGGGGG - Intergenic
1004403254 6:15308211-15308233 CATAGAAATGATATTTAACATGG - Intronic
1005915349 6:30346140-30346162 CAAAGAAATGAGAGTTCAGGAGG + Intronic
1010217981 6:73421708-73421730 TATAACAATGTGATTTATGGTGG + Intronic
1012584042 6:100900698-100900720 TCTAGCAATGTGATTTAGGGTGG - Intergenic
1014062116 6:117083452-117083474 CATAGCTGTGAGATTGCAGGTGG - Intergenic
1017100687 6:150847324-150847346 CAATGCTATGAGATCTAAGGAGG + Intergenic
1018210914 6:161480823-161480845 TATAGCAATGAAATTAAAAGCGG - Intronic
1019767021 7:2858986-2859008 CAAAGCACTGAGATTATAGGTGG - Intergenic
1026609280 7:71843184-71843206 CATAGGAAAGAAATTTAAAGAGG - Intronic
1028015316 7:85703471-85703493 CACAACAATGAGATTTAAGAAGG - Intergenic
1028111464 7:86947558-86947580 CATTGCAATGAGTTTTCATGAGG - Intronic
1031001067 7:116415331-116415353 GATAGCCATGAGATTTGGGGAGG - Intronic
1032860790 7:135877290-135877312 CACAGAAATGAGATGTAAGTTGG + Intergenic
1034647779 7:152663891-152663913 CACAGCAATGTGATTTATGGTGG + Intronic
1034930898 7:155163115-155163137 CAAAGCACTGAGATTACAGGCGG + Intergenic
1035672200 8:1426783-1426805 CTTAGACATGAGATTTTAGGTGG - Intergenic
1038215045 8:25554167-25554189 TATAGCATTGTGATATAAGGAGG - Intergenic
1039193244 8:35001096-35001118 CATATCAATGGGAAGTAAGGGGG - Intergenic
1040969434 8:53117780-53117802 CATAGAAATGATATTTCAGGGGG + Intergenic
1041168394 8:55114968-55114990 CATCACAAAGAGATTTAGGGGGG - Intronic
1041636843 8:60154511-60154533 CATTGCAATGACATTTAGGGTGG - Intergenic
1041759016 8:61343881-61343903 CCTAGCACTAAGATTTAAAGTGG - Intronic
1043495152 8:80792145-80792167 CATGGGAAAGAGATTCAAGGTGG + Intronic
1045061566 8:98415904-98415926 CACATCACTGAGATTTGAGGGGG - Intronic
1046739516 8:117813341-117813363 CATAGAAGTGACATTTAAGCAGG + Intronic
1047030900 8:120879608-120879630 CATAGCACTGAGTTTTCAGTAGG + Intergenic
1048904145 8:139071083-139071105 AAAAGCAATTAGATTTAAAGGGG + Intergenic
1052232529 9:26171586-26171608 CATAGGAATGAGACTTTGGGTGG + Intergenic
1053280126 9:36815063-36815085 AATAGCAATGAGAAATAATGAGG - Intergenic
1056223634 9:84473652-84473674 GCTAGCAATGTGATTTATGGTGG + Intergenic
1056469207 9:86888679-86888701 AATAGCAATCAAATTTAAGGTGG + Intergenic
1057049747 9:91914669-91914691 CTGACCAATGAGATGTAAGGGGG - Intronic
1057105276 9:92408911-92408933 CATAAGTATGAGATTTAAGACGG - Intronic
1058740182 9:107935094-107935116 CATAGCAATAAGTTTTAATGAGG + Intergenic
1059978828 9:119746890-119746912 CAGAGTAGGGAGATTTAAGGTGG + Intergenic
1186529464 X:10280534-10280556 AATAGCAGTGACATTTGAGGAGG + Intergenic
1189963143 X:46344331-46344353 GGTAGCAATGAGACTTAAAGAGG + Intergenic
1189967187 X:46386993-46387015 CAAAGAAATGAGAGTCAAGGAGG - Intergenic
1194671460 X:96738812-96738834 AATAGCACTGAGTTTTAAGGAGG + Intronic
1196038730 X:111176829-111176851 CATAGTAAATAGATTTAAGCCGG - Intronic
1197532821 X:127651370-127651392 TATAGAAGTGAGATTTTAGGTGG + Intergenic
1198539315 X:137619855-137619877 TATAGCAATGAAATTAAAGTTGG - Intergenic
1198697511 X:139358155-139358177 CATAGCAAACAGATTCAAGATGG - Intergenic
1199887799 X:152039482-152039504 TATGGTAATGAGATTTAAGAAGG - Intergenic
1200208062 X:154332268-154332290 CAGAGCAATAAGATGTTAGGAGG - Intergenic
1201259551 Y:12145170-12145192 TCTAGCAATGTGATTTAGGGTGG - Intergenic
1201485133 Y:14485975-14485997 CATAGCAAAGAGGTTTTATGTGG + Intergenic