ID: 1132174085

View in Genome Browser
Species Human (GRCh38)
Location 15:99694669-99694691
Sequence TCATACTGTAGCCTTTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132174080_1132174085 17 Left 1132174080 15:99694629-99694651 CCAGGTTTCTTTTCTGTGAAGTT 0: 1
1: 1
2: 15
3: 93
4: 653
Right 1132174085 15:99694669-99694691 TCATACTGTAGCCTTTGGGTAGG 0: 1
1: 0
2: 2
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132174085 Original CRISPR TCATACTGTAGCCTTTGGGT AGG Intronic
902838449 1:19060757-19060779 CCATGCCCTAGCCTTTGGGTGGG + Intergenic
903045833 1:20563581-20563603 TCATTCTGCAGCCTTTGAGATGG + Intergenic
903238239 1:21964656-21964678 TCTTACTCTGGCCTTTGGCTTGG - Intergenic
910289222 1:85583576-85583598 TCAAAATGTAGCTTTTGGGGAGG + Exonic
912098335 1:106173322-106173344 ACACACTGGAGCCTTTTGGTGGG + Intergenic
917586149 1:176428452-176428474 TCATATTGTTCCTTTTGGGTTGG + Intergenic
922417663 1:225436284-225436306 TCTGAATGTAGACTTTGGGTGGG - Intergenic
1064157418 10:12915685-12915707 TGCTACTGGAGCCTTTGGGTAGG + Intronic
1071013760 10:80970387-80970409 TCATCCTGTATCATTTGGTTTGG - Intergenic
1073673378 10:105617399-105617421 TCTTCCTGTAGGCTCTGGGTAGG - Intergenic
1078085729 11:8232127-8232149 GCACACTGTAGCCTGTGGGTGGG - Intronic
1080600137 11:33814472-33814494 AAATATTGTAGCCTTTGGATAGG + Intergenic
1084828846 11:71752548-71752570 CCATTTTGTAGCATTTGGGTAGG - Intergenic
1084877300 11:72142677-72142699 TCCTAGGGTAGCCTTCGGGTTGG + Intergenic
1085760990 11:79241384-79241406 GCATCCTGTAGCCTGTGTGTTGG + Intronic
1089637530 11:119825133-119825155 TGATGCTGATGCCTTTGGGTGGG + Intergenic
1090386124 11:126358406-126358428 TCATACAGAAGCCTCTGGGAAGG - Intronic
1091029982 11:132177372-132177394 TCATACTGTGGCCAGTGGATTGG - Intronic
1092509195 12:9135558-9135580 TCATACTGTAGTTTTTGGAAGGG - Intergenic
1093176233 12:15916389-15916411 TCATACTCCAGTCTTTGGGCTGG + Intronic
1095799531 12:46257532-46257554 TCAATCTATTGCCTTTGGGTTGG + Intronic
1101487348 12:105178555-105178577 TCCAACTGTAGCCTTTTGTTGGG - Intronic
1103802344 12:123547004-123547026 GCCTACTGTAGCCTTTCAGTAGG - Intergenic
1114211225 14:20616883-20616905 TAATAGTCTTGCCTTTGGGTAGG + Intergenic
1114446136 14:22789700-22789722 TCATTCTGTATTCTCTGGGTGGG + Intronic
1114794365 14:25695792-25695814 TCATTCAGTAGCTTTGGGGTGGG + Intergenic
1118315990 14:64726504-64726526 TCAGGCTGCAGCCTTTGGGAAGG - Intronic
1118746882 14:68780742-68780764 GCATCCTGTAGCTTTTGGGTTGG - Intergenic
1123955778 15:25333000-25333022 TCTTACTGAGGTCTTTGGGTGGG + Intergenic
1128586681 15:68858589-68858611 TCATACTCTAGCCTTTGGATGGG + Intronic
1128648474 15:69393896-69393918 TCATTCTGTAGCATTTGAGAGGG + Intronic
1132174085 15:99694669-99694691 TCATACTGTAGCCTTTGGGTAGG + Intronic
1137638920 16:50011386-50011408 TCACACTGAAGCCTTTGGGCTGG - Intergenic
1138039046 16:53642450-53642472 CCAAACTCTAGACTTTGGGTAGG + Intronic
1138140147 16:54560931-54560953 TCAGACTGCAGCCATTGTGTGGG + Intergenic
1140822542 16:78676525-78676547 TTAGACTGTAGACTTTGAGTTGG - Intronic
1143297981 17:5885516-5885538 TTGTCCTGTATCCTTTGGGTGGG + Intronic
1145879308 17:28342076-28342098 TCATAGGGTACCCTCTGGGTTGG - Intronic
1146712566 17:35055310-35055332 TCATAATGAAGAATTTGGGTAGG - Intronic
1149220089 17:54407126-54407148 TGATACTGTAGGATTTGGGATGG + Intergenic
1150130492 17:62666368-62666390 ACCTAGTGTAGCCTTTTGGTGGG + Intronic
1150365559 17:64580783-64580805 TCATACCATAGCCTTCTGGTAGG + Exonic
1151093989 17:71475465-71475487 TCATAATGTTGGCTTTGAGTTGG - Intergenic
1151842579 17:76628514-76628536 TCAGACTGTTTCCTTAGGGTTGG + Intronic
1153473544 18:5471986-5472008 TCATACTGTAGGCTGTGTTTTGG - Intronic
1155005084 18:21721687-21721709 TAAAACTGTAGCTTGTGGGTAGG + Intronic
1156819445 18:41354969-41354991 TCATTCTTTCTCCTTTGGGTGGG + Intergenic
1157905608 18:51567303-51567325 ACATACTCTAGTCTTTGGGAAGG + Intergenic
1159242106 18:65754687-65754709 TCCTATTGTACCCTTTTGGTTGG - Intronic
926883456 2:17574687-17574709 CCATGCTGTAATCTTTGGGTTGG + Intronic
927128331 2:20034211-20034233 TCATGCTGTAACCTATGGTTTGG - Intronic
927949005 2:27154968-27154990 TAATAGAGTAGACTTTGGGTTGG + Exonic
929098937 2:38290656-38290678 TCATGCAATAGCCTTGGGGTGGG - Intergenic
929184607 2:39080439-39080461 TCAGTCTGTAGCCTGGGGGTTGG + Intronic
933242692 2:79940751-79940773 ACTTACAGTAGCCTATGGGTGGG + Intronic
933340052 2:81012839-81012861 TCATACTGAAGATTTTGGATTGG - Intergenic
935086215 2:99847846-99847868 TCATTCTAAAGCCTCTGGGTGGG + Intronic
935133748 2:100280402-100280424 TCAGAATGTGGCCTTTGGGAAGG + Exonic
936085652 2:109467163-109467185 TCATGCAGGAGCCTTTGTGTAGG - Intronic
936086919 2:109475517-109475539 TCATACAGTTGGCTGTGGGTGGG + Intronic
940564549 2:155344188-155344210 ACATACTGTAGCCTATAGTTGGG + Intergenic
944826863 2:203492511-203492533 TCATACTGTATACTTTGGGTAGG + Intronic
1170997150 20:21373368-21373390 TTATCCAGTAGCATTTGGGTTGG + Intronic
1174595043 20:51677228-51677250 TCATAGTGTGGCTGTTGGGTTGG - Intronic
1176343968 21:5724024-5724046 GCATAGTGGGGCCTTTGGGTAGG + Intergenic
1176500859 21:7600432-7600454 GCATAGTGGGGCCTTTGGGTAGG - Intergenic
1176538289 21:8122093-8122115 GCATAGTGGGGCCTTTGGGTAGG + Intergenic
1179297104 21:40072807-40072829 TCCTACTGAAACCTTTGTGTTGG + Intronic
1184745102 22:46451563-46451585 TGCTACTGGAGCCTTTGGCTTGG - Intronic
1203243236 22_KI270733v1_random:38449-38471 GCATAGTGGGGCCTTTGGGTAGG + Intergenic
951807619 3:26663888-26663910 TTCTACTATAGCCTTTGAGTTGG + Intronic
952045668 3:29316225-29316247 TCATATTGTAGAGTTTGGTTGGG - Intronic
952252499 3:31668426-31668448 TCATTCTGTAGTCATGGGGTGGG - Intronic
953976237 3:47383717-47383739 TCACACAATACCCTTTGGGTCGG - Intronic
954760360 3:52869413-52869435 TCATACTGTCCCCTTGGCGTGGG + Intronic
954964888 3:54601536-54601558 TGATCCTGCAGGCTTTGGGTGGG - Intronic
955493177 3:59503456-59503478 ACATACTGTGGCCTTTTGGAGGG - Intergenic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
956826219 3:72998877-72998899 TCTTTTTGTAGTCTTTGGGTGGG + Intronic
959858624 3:111191018-111191040 TCATACTGTCCCTTTTGGTTTGG - Intronic
962398414 3:135037283-135037305 TCAGACTGTGGCCTCTGGGGAGG + Intronic
962726034 3:138227784-138227806 TGATACTGTAGGTTTGGGGTAGG - Intronic
963615034 3:147525935-147525957 GCATCCTGCAGCCTGTGGGTTGG + Intergenic
963885497 3:150577308-150577330 TCAGACTGTAGCAGTGGGGTAGG + Intronic
970685049 4:18557869-18557891 TAATGCTGTAGCTTTTGGTTTGG + Intergenic
977305716 4:95320707-95320729 TCTTATTGTAGCCTCTGCGTGGG + Intronic
985758335 5:1732417-1732439 TCATCCTCTGGCCTTTGGGTGGG + Intergenic
989119974 5:37995241-37995263 TCATTCTTGAGCCTTTGAGTTGG - Intergenic
990993847 5:61711743-61711765 ACATACTGGAGCCTGTGGGGTGG + Intronic
992209105 5:74460075-74460097 TCATTCTGAGGCCTTTGGATTGG + Intergenic
995753190 5:115474914-115474936 TGATTCTGTAGGCCTTGGGTGGG - Intergenic
996649970 5:125863972-125863994 TCCTCCTGTAGCCTTTTGGGTGG - Intergenic
998471202 5:142385297-142385319 TCATCCAGCAGCCATTGGGTGGG + Intergenic
999645695 5:153715001-153715023 TCCTACTTCTGCCTTTGGGTGGG - Intronic
1007049859 6:38816245-38816267 ACATACTGGAGCCTGTTGGTGGG - Intronic
1011507864 6:88067915-88067937 TCCTACAGATGCCTTTGGGTGGG - Intergenic
1013944213 6:115703575-115703597 TGATACTGGAGTCCTTGGGTAGG + Intergenic
1016251033 6:142043138-142043160 TGATACAGTAGGCTTTGGGTGGG + Intergenic
1016790683 6:148064430-148064452 TCCTACAGGAGCATTTGGGTTGG - Intergenic
1018871795 6:167789813-167789835 TGAGACTGGAGCCTGTGGGTTGG - Intronic
1020787111 7:12587330-12587352 TAATATTGTAGCCTGGGGGTGGG + Intronic
1024401329 7:48927642-48927664 TCTCACTGTTGCCTTTGGCTAGG + Intergenic
1027990459 7:85353576-85353598 TCTTACTGTAATCTTTGGCTTGG - Intergenic
1030435450 7:109513781-109513803 TCATACTGTACTCTTTGGACAGG + Intergenic
1032950036 7:136897445-136897467 TCATGCTGTATCCTTTTGGAAGG + Intronic
1037469483 8:19193530-19193552 CCCTACTGTAGCATCTGGGTGGG - Intergenic
1038365071 8:26923343-26923365 TCATAATTTAGCCTTTGGCCGGG - Intergenic
1038510536 8:28130359-28130381 TTATTCTGTAGGATTTGGGTAGG + Intronic
1039338883 8:36624688-36624710 TCAAAATGTAGCCATTAGGTAGG + Intergenic
1041561755 8:59226265-59226287 TCCTACAGGTGCCTTTGGGTTGG + Intergenic
1042077765 8:65015211-65015233 TCATAGTACAGCCTATGGGTGGG - Intergenic
1045893139 8:107181839-107181861 TCATATTGTTGCCTTTGAATTGG + Intergenic
1045979162 8:108163666-108163688 ACATACTGTACCCTCTGGTTGGG + Intergenic
1046550404 8:115708606-115708628 TCCTACTGTAGCATTTAGCTGGG + Intronic
1047520263 8:125590603-125590625 TCATTCTTTAGCCTTAGAGTGGG - Intergenic
1052575579 9:30286122-30286144 TCATATTGTAACCTTTGTCTTGG + Intergenic
1057606643 9:96502717-96502739 TCTCACTGTTGCCTTTGGTTAGG - Exonic
1060153817 9:121305230-121305252 TCTCACTGTAGCCTTTAGGGTGG + Intronic
1062169139 9:135124919-135124941 TCATCTTGTAGACTCTGGGTTGG - Intergenic
1203459561 Un_GL000220v1:21531-21553 GCATAGTGGGGCCTTTGGGTAGG + Intergenic
1203490051 Un_GL000224v1:96139-96161 TCATCCTGTAGCCTTTCTTTAGG - Intergenic
1203502674 Un_KI270741v1:38022-38044 TCATCCTGTAGCCTTTCTTTAGG - Intergenic
1186601433 X:11041833-11041855 CCATCCTGTGGCCTTTGGTTGGG - Intergenic
1187956588 X:24524716-24524738 TTCTGCTGTAGTCTTTGGGTTGG - Intronic
1188316747 X:28683913-28683935 TCATCCTGTGGTCTTTGGGTGGG - Intronic
1188735200 X:33704328-33704350 ACACACTGTAGCCTTTTGGAGGG - Intergenic
1189782768 X:44532090-44532112 TCATACTGTACTCTTTGGAAGGG - Intronic
1189919106 X:45886160-45886182 TCATATTGTAGCTTTTATGTGGG + Intergenic
1191735874 X:64387357-64387379 GCATAATGTAGCCGTTTGGTAGG - Intronic
1195170017 X:102258280-102258302 TTAGAATGTAGTCTTTGGGTTGG - Intergenic
1195188840 X:102428820-102428842 TTAGAATGTAGTCTTTGGGTTGG + Intronic
1200690706 Y:6305034-6305056 CCTTACTGGAGCCTGTGGGTCGG + Intergenic
1200714329 Y:6520480-6520502 CCTTTCTGTAGCCTGTGGGTGGG - Intergenic
1200857248 Y:7952280-7952302 TCATAGTGTTGCCTGTGGGCAGG + Intergenic
1201019494 Y:9640676-9640698 CCTTTCTGTAGCCTGTGGGTGGG + Intergenic
1201044566 Y:9869682-9869704 CCTTACTGGAGCCTGTGGGTCGG - Intergenic