ID: 1132175505

View in Genome Browser
Species Human (GRCh38)
Location 15:99711025-99711047
Sequence CAGGATCTGAAGGGGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132175497_1132175505 11 Left 1132175497 15:99710991-99711013 CCCATAGGGACATCCTGAGGTAG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG 0: 1
1: 0
2: 0
3: 21
4: 216
1132175498_1132175505 10 Left 1132175498 15:99710992-99711014 CCATAGGGACATCCTGAGGTAGA 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG 0: 1
1: 0
2: 0
3: 21
4: 216
1132175499_1132175505 -2 Left 1132175499 15:99711004-99711026 CCTGAGGTAGAGAGACTCAACCA 0: 1
1: 0
2: 3
3: 2
4: 121
Right 1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG 0: 1
1: 0
2: 0
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132175505 Original CRISPR CAGGATCTGAAGGGGTCTGA AGG Intronic
905906201 1:41619995-41620017 CAGGCTCTGCAGGGGTTTGGGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906667478 1:47631940-47631962 CAGGTTCTAATGGGGGCTGAAGG - Intergenic
907870823 1:58441199-58441221 CAAGTACTGAAGGGATCTGAAGG + Intronic
908923721 1:69227268-69227290 CAGCATCTCAAGGGCTCTGTAGG - Intergenic
909344885 1:74573160-74573182 CAGAAGCAGAAGGGGTCAGAAGG - Exonic
911355292 1:96810442-96810464 TAGGATCTGAAGTGATCTAAAGG - Intronic
911494893 1:98619406-98619428 CAGGACCTGTCGGGGTGTGAGGG - Intergenic
911562891 1:99428358-99428380 CAGCATCTGAAGAGGTCATATGG - Intergenic
912933998 1:113986994-113987016 CAGGCTCTGATGGGGTGAGACGG - Intergenic
913608828 1:120491383-120491405 CAGGAGCTGACGGGGTGGGAGGG + Intergenic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914582368 1:149030455-149030477 CAGGAGCTGACGGGGTGGGAGGG - Intronic
915283074 1:154836006-154836028 CAGGATCTGAGGGCGTCTGGAGG + Intronic
916160966 1:161914337-161914359 CAAGATGTTAAGGGGACTGAAGG - Intronic
918094432 1:181322871-181322893 CAGCAGCTGAATGGGGCTGAGGG + Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
919944582 1:202309989-202310011 CCTGATCTGAAGGGCTCTGGAGG - Intronic
920107392 1:203563623-203563645 CAGGAGGAGAAGGGGGCTGAGGG - Intergenic
920398303 1:205661900-205661922 CAGGATCTGCAGGGCTGAGAAGG + Exonic
920669660 1:207993610-207993632 CAGGCTCTGAAGGGAGCTTAGGG + Intergenic
920871851 1:209801411-209801433 CATGATCTGGGGGGGTCAGAGGG + Exonic
922558411 1:226549775-226549797 CAGGAACAGAAGGGATCCGAGGG - Intronic
922791242 1:228312247-228312269 CATGTTCTGAAGGGGTGTGTGGG + Intronic
922854541 1:228763344-228763366 CAGGGTCAGTAGGGGTCTGGAGG - Intergenic
923143366 1:231180499-231180521 CAGTATCTGAAGGGGGGTGCAGG - Intronic
924629909 1:245727160-245727182 CAAGATCAGAAGGGAACTGAAGG + Intergenic
1062957344 10:1549045-1549067 GAGAATCTGAAGACGTCTGAGGG + Intronic
1063676252 10:8142838-8142860 CTGGATGTGAAGAGCTCTGAAGG + Intergenic
1064246113 10:13668846-13668868 CAGGAACTGCAGGGGACGGAGGG - Intronic
1064281388 10:13954636-13954658 CAGGGTCTGCAGGGCCCTGATGG - Intronic
1067669883 10:48309467-48309489 CAGGATCTAAAGGAGTATGAAGG - Intronic
1067796960 10:49327702-49327724 CAGGAACTGATGGGGGGTGAGGG - Intergenic
1068357528 10:55928909-55928931 CAGGATTTGAAGGGGAAAGAAGG - Intergenic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1070325070 10:75383505-75383527 CAGGAAATGCTGGGGTCTGAGGG - Intergenic
1070671784 10:78382543-78382565 CAGAATCTGCAGGGGTCTAAGGG - Intergenic
1070961466 10:80502897-80502919 CAGCATCTAGAGGGGTCTGAAGG + Intronic
1071275239 10:84048311-84048333 CAGGAACTCTAGGGGACTGAAGG - Intergenic
1071601280 10:86959790-86959812 CATGGTCTGCAGGGGTCTGTAGG - Intronic
1076546061 10:131246387-131246409 CTGGACCTGGAGGGGTCTGCTGG + Intronic
1077181656 11:1219695-1219717 CGGCCTCTGAAGGGGTCTGTGGG + Intergenic
1080429891 11:32188689-32188711 CAGGGTCTCTAGGGTTCTGAGGG - Intergenic
1081150679 11:39627007-39627029 CAGCATCTGAAAGAGTATGAGGG - Intergenic
1081659074 11:44876978-44877000 CAGGCTCTGCAGGGGCCTGGGGG - Intronic
1081948958 11:47026003-47026025 CAGGATCTGCAGATGACTGAGGG + Intronic
1084589816 11:70084166-70084188 CAGGGTCTCGAGGGGTCGGAGGG - Intronic
1089656545 11:119951173-119951195 CAGGAGGTGAATGGGTCTTAAGG + Intergenic
1090076435 11:123582632-123582654 GAGGAGCTGGAGGGGGCTGAGGG - Intronic
1094113891 12:26889543-26889565 CAGGACCAGAAAGGCTCTGAGGG - Intergenic
1096661648 12:53128979-53129001 CAGGATCCTCAGGGGTCAGAGGG + Intergenic
1098006550 12:66003571-66003593 CAGGCCCTGCAGGGGTCCGAGGG + Intergenic
1099040398 12:77646129-77646151 CAGCATCTGAATGGGCCAGAGGG + Intergenic
1099219985 12:79902000-79902022 CAGGATATTTAAGGGTCTGAAGG + Intronic
1105301876 13:19142613-19142635 GAGGATTTGGAGGGGCCTGATGG + Intergenic
1108768466 13:53664438-53664460 CAGGATCAGAACGGAACTGAAGG - Intergenic
1109717658 13:66237228-66237250 CAAGATCTGCAAGAGTCTGAAGG - Intergenic
1112526552 13:100153584-100153606 CAGGATCTGAAGTGGACAGAGGG + Intronic
1113463131 13:110495718-110495740 GAGGATCTGATGGGGTCTCTAGG - Intronic
1113843860 13:113375138-113375160 TGGGGTCTGATGGGGTCTGATGG + Intergenic
1113843921 13:113375368-113375390 CAGGAACTAATGGGGTGTGATGG + Intergenic
1113843941 13:113375448-113375470 CAGGAACTAATGGGGTGTGATGG + Intergenic
1113843982 13:113375608-113375630 CAGGAACTAATGGGGTGTGATGG + Intergenic
1114568035 14:23646829-23646851 CAGGATCTGAACAGGTGGGACGG + Intergenic
1115754960 14:36520496-36520518 GAGGATGGGAAGGGGTCTCACGG + Intronic
1116250716 14:42479635-42479657 CAGGAGGTGAAGGAATCTGATGG - Intergenic
1116257209 14:42571308-42571330 CAGGCCAAGAAGGGGTCTGAAGG + Intergenic
1116405735 14:44563880-44563902 AAGGATCTCAGTGGGTCTGAAGG + Intergenic
1116689386 14:48085262-48085284 CAGTATCTGGAGGGGCCTCAGGG + Intergenic
1116758369 14:48978202-48978224 CAGGGTCTGTTGGGGTGTGAGGG - Intergenic
1117309931 14:54510935-54510957 CATGGTCTGAAGAGGTCAGAGGG + Intronic
1117878591 14:60282950-60282972 CAGGATTTTAAAGGGTCTGCAGG + Exonic
1118740263 14:68734290-68734312 GAGGATGTGCAGGGGCCTGAGGG - Intergenic
1119431615 14:74571700-74571722 CTGCATCTGCAGGGGTCTGGCGG - Intronic
1119784684 14:77303636-77303658 CAGGCCCTGCAGGGATCTGAGGG - Intronic
1120952147 14:90051257-90051279 GAGGATCTGAATGGGTAGGAAGG + Intergenic
1121418564 14:93796239-93796261 CAGGATCTGAAAAGATCTGGTGG + Intergenic
1121438542 14:93934498-93934520 CAGGATCTCACTGGGTCTCAGGG - Exonic
1121974949 14:98394283-98394305 CAGAATCTGAAGGTATTTGAAGG + Intergenic
1127152431 15:56090510-56090532 CTGGATCTGAAGGTGTTTTATGG - Exonic
1132175505 15:99711025-99711047 CAGGATCTGAAGGGGTCTGAAGG + Intronic
1133785095 16:8967288-8967310 AAGGACATGAAGGGCTCTGAAGG + Intergenic
1136188194 16:28600557-28600579 CTGGATCCGAAGTGGTCTGGGGG + Intergenic
1136190666 16:28613551-28613573 CTGGATCCGAAGTGGTCTGGGGG + Intronic
1136318443 16:29467166-29467188 CAGGATCCGAAGTCGTCTGGAGG - Exonic
1136399518 16:30010082-30010104 CAGGACCTGAAGGGGGCGGCGGG - Exonic
1136433018 16:30206515-30206537 CAGGATCCGAAGTCGTCTGGAGG - Exonic
1136933059 16:34436075-34436097 CAGGATGTGAAGGGGAATGATGG - Intergenic
1136971513 16:34975739-34975761 CAGGATGTGAAGGGGAATGATGG + Intergenic
1137236531 16:46623070-46623092 CAGGCCCTGCAGGGGTCCGAGGG + Intergenic
1139852442 16:69959359-69959381 CAGGAGCTGAAGGGGCCAGGGGG + Intronic
1139881413 16:70182267-70182289 CAGGAGCTGAAGGGGCCAGGGGG + Intronic
1140056073 16:71526786-71526808 CAGGATCTGAACGAGTCAGTTGG - Intronic
1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG + Intergenic
1144170286 17:12653395-12653417 CAGCATCTCAGGGGTTCTGATGG + Intergenic
1144345834 17:14348424-14348446 AAGGGTCTGCAAGGGTCTGATGG + Exonic
1145883974 17:28370174-28370196 CAGTATGAGAAGGGGTCTCAGGG + Exonic
1148135990 17:45292260-45292282 GAGGATCTTAAGAAGTCTGAGGG + Intronic
1148153388 17:45409617-45409639 CAGAGTTTGAAGGGGCCTGAAGG - Intronic
1148204478 17:45771261-45771283 CAGGATATGACGGGATATGAGGG + Intergenic
1148340013 17:46867746-46867768 GAGGATCAGAAGAGATCTGAGGG + Intronic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1148763356 17:50021054-50021076 CAGTATCTGAAAGGGTGTGAGGG - Intergenic
1151683385 17:75633530-75633552 CAGCATCTGAAGGCGTCTTGGGG - Intronic
1152174995 17:78781845-78781867 CAGGATCTCAGGGGCTCTGAGGG - Intronic
1152294110 17:79456729-79456751 CAGGCTCTGAAGGGCCCTGGGGG - Intronic
1152298838 17:79483884-79483906 CGGGATATGGAGGGGACTGAAGG + Intronic
1152466579 17:80469962-80469984 CAGGATCTGAGGAGGTGGGAAGG + Exonic
1152496518 17:80676592-80676614 CAGCATCTGGAGGGGTCTGCAGG + Intronic
1155381684 18:25229439-25229461 CAGCATAAGAAAGGGTCTGATGG + Intronic
1156445415 18:37233221-37233243 CAGTATCTGTAGGGATCTGATGG + Intergenic
1157923078 18:51733725-51733747 TGGAAACTGAAGGGGTCTGAAGG + Intergenic
1158817026 18:61113479-61113501 CAGGATATGGAGGAGTCTGCTGG + Intergenic
1160662870 19:309155-309177 CAGGAGCTGGAGGGCTCTGAGGG - Intronic
1161394286 19:4037184-4037206 CAGCACCTGCAGGGGCCTGAGGG + Intronic
1164504386 19:28847291-28847313 CAGGCTCTGATAGTGTCTGAGGG - Intergenic
1165471350 19:36006588-36006610 CAGGACCTGGTGGGGTCTGGGGG - Exonic
1166989326 19:46681743-46681765 CAGGATCTGAGGGGAGCAGATGG + Exonic
925454255 2:4001072-4001094 CAGGGTCTGAAGGGGGCAAAAGG - Intergenic
925843925 2:8018937-8018959 CAGGACATAAAGGGGGCTGAGGG + Intergenic
926016859 2:9460918-9460940 CAGGATCTAATGGTGTGTGAAGG - Intronic
926576342 2:14586420-14586442 CTGGCTCTGAAGGTATCTGAAGG + Intergenic
926983714 2:18598507-18598529 TATGATCTGAAAGGGACTGAGGG + Intergenic
928171582 2:29007813-29007835 CAGGGTCTGGAGGGGTAAGAAGG - Intronic
933739723 2:85524003-85524025 CAGGATCTGAGGGCTTCTAAAGG + Intergenic
940374945 2:152947235-152947257 AAGAGTCTGAAGGGGTCTGAGGG + Intergenic
941541698 2:166794120-166794142 CAGGACCTAAAGGGATCTTATGG - Intergenic
941542151 2:166800367-166800389 CAGGACCTAAAGGGATCTTATGG - Intergenic
941601196 2:167545715-167545737 CTGAATCTGAAGGAGTCTGTGGG - Intergenic
948125398 2:235561316-235561338 CAGGAGCTGCTGGGGTCTGCGGG + Intronic
948263643 2:236622251-236622273 GAGGCTTTGAAGGGGACTGATGG + Intergenic
948589447 2:239039790-239039812 CAGGATCTGTAGGGGAATGCAGG + Intergenic
1168993622 20:2115864-2115886 CCAGATCTGAAGGTGTCAGAGGG - Intronic
1171486702 20:25490946-25490968 CTGGAGCTGATGGGGTTTGATGG - Intronic
1172446687 20:34996990-34997012 CAGGGCCTGAAGGGGACTGGGGG + Intronic
1173860678 20:46281297-46281319 CAGGATTAGAAGGGATCTCAGGG - Intronic
1173979409 20:47211680-47211702 CAGGATGTGATGGGATCTTAGGG - Intronic
1175190881 20:57211474-57211496 CAGGACCTGGATGTGTCTGAGGG - Intronic
1178875105 21:36408252-36408274 CAGGTTCTGAAGGAGGCTGGAGG + Intronic
1179571040 21:42279140-42279162 CAGCATCTGGAGGGGTCTTTGGG - Intronic
1181022806 22:20112519-20112541 CAGGAGCTGAAGGGCTCCCAGGG - Exonic
1182282707 22:29226419-29226441 CAGAGACTGAAGGGTTCTGAGGG + Intronic
1182490032 22:30665476-30665498 CAGGATCTGATGGGTTCATAAGG - Intronic
1182853380 22:33495826-33495848 CTGGATCTGCTGTGGTCTGAGGG + Intronic
1183317821 22:37146531-37146553 CAGGATCTGTAGGGGACCCAGGG - Intronic
950721185 3:14883812-14883834 CAGAATCTGCAGGGGCATGAGGG + Intronic
951479203 3:23141694-23141716 CAGGAACTTAAGGGGGCTCAAGG + Intergenic
954433494 3:50483774-50483796 CCATATCTCAAGGGGTCTGATGG + Intronic
954582500 3:51710667-51710689 CAGGATTTGAGGGGGTGGGAAGG + Intronic
956185821 3:66560954-66560976 CACTATCTGATGGGATCTGATGG - Intergenic
956233110 3:67039469-67039491 GAGGACCGTAAGGGGTCTGAAGG + Intergenic
960056492 3:113279728-113279750 CAGGACCTGGAGGGGTCTTCTGG - Intronic
961749651 3:129087768-129087790 CAGGCCCTGCAGGGGTCCGAGGG + Exonic
962448642 3:135492708-135492730 CAGGGTCTGGTGGGGTCTAAGGG + Intergenic
964415526 3:156443930-156443952 CAGGTCCTCAAGGGGGCTGAGGG - Intronic
964958908 3:162398761-162398783 CAGGACCAGAAGGCGTCAGAGGG - Intergenic
968706274 4:2079915-2079937 CAGTAACTGAAGTGGTCAGAAGG - Intronic
969595881 4:8149045-8149067 CAGAGTGTGAAGGGGTCTGTAGG + Intronic
972683550 4:41329988-41330010 CAATATCTGAAGTGGTCTTATGG + Intergenic
974011000 4:56607174-56607196 CAGGAGGTGATTGGGTCTGAAGG + Intergenic
974038966 4:56841632-56841654 GAGGCTCTGAAGGAGCCTGAGGG + Intergenic
974154559 4:58054669-58054691 TATGATCTGAAGTGATCTGATGG - Intergenic
976522324 4:86042898-86042920 TTGGATGTGAAGGGGGCTGAGGG + Intronic
978663479 4:111154815-111154837 CAAAATCTGGAGGGGGCTGATGG + Intergenic
979453706 4:120902890-120902912 CAGGGTATGAAGGGATCTTAGGG - Intronic
980349507 4:131667902-131667924 CAGGATGTTAAGGGGTATAAAGG - Intergenic
983056216 4:163101558-163101580 GAGGATGGTAAGGGGTCTGAAGG + Intergenic
983435229 4:167706681-167706703 CTGGATCTGAAGGGGAAAGAAGG + Intergenic
984462484 4:180055952-180055974 AAGGTTCTGAAGGGGACAGAGGG - Intergenic
985707680 5:1410981-1411003 CAGGATCTGTAGGTGGCTCAGGG + Intronic
986212826 5:5690204-5690226 CAGGCCCTGAAGGGGAGTGAGGG - Intergenic
986569972 5:9154574-9154596 CAGGATCTGCAGGCTCCTGATGG + Exonic
986670388 5:10138366-10138388 TAGGTTCTGAAAGGGTCAGAGGG + Intergenic
988196058 5:28007553-28007575 AGGGATCTGAAGGGGTAAGAGGG + Intergenic
989509613 5:42269903-42269925 CATGATCTGAGGTAGTCTGACGG - Intergenic
990621671 5:57566634-57566656 CAGGTTGGGAAGGGGTGTGAAGG + Intergenic
991157267 5:63453778-63453800 TAGGATTTGAATGGATCTGAGGG - Intergenic
996360539 5:122640441-122640463 CAGTAACTGAAGGGCCCTGAAGG + Intergenic
998420485 5:141980632-141980654 CAGGATATGAAATGTTCTGAAGG + Intronic
999281873 5:150371447-150371469 CAGGGCCGCAAGGGGTCTGATGG + Intronic
999742367 5:154566051-154566073 CAGAGTCTGCAGGGGTTTGAAGG + Intergenic
1000097943 5:157987431-157987453 AAGGAGCTGAAGGTGGCTGAGGG - Intergenic
1002956387 6:1869492-1869514 CAGGAGCTGAAGGGCTGTCAAGG + Intronic
1003220310 6:4155314-4155336 CATGATCTGAACGTGTCTTAAGG + Intergenic
1003590529 6:7433012-7433034 CTGGAGCTGCAGGGGTGTGAAGG + Intergenic
1003886863 6:10529524-10529546 CAGTATCTGAAGGGATTTAAAGG + Exonic
1005198811 6:23319566-23319588 CTGGAGCTGAAGGGGACAGAGGG + Intergenic
1007274413 6:40662852-40662874 CAGGATCTCCAGGTGTCTGTGGG + Intergenic
1007451786 6:41945608-41945630 CAGCATCTCAATGGGTCTGAAGG - Intronic
1008960453 6:57260908-57260930 CATGATCTCCAGGGGTATGAAGG + Intergenic
1009959975 6:70507357-70507379 CAGGAACTGAAGTAGTCTAAAGG + Intronic
1011851768 6:91638286-91638308 CAGGATCAGTAGGCATCTGAGGG - Intergenic
1011867468 6:91848249-91848271 CTGGATGTGAAGGCCTCTGAAGG + Intergenic
1014904065 6:127004879-127004901 CAGGACCTGAAGGGGCCTGCAGG + Intergenic
1016743582 6:147554161-147554183 CAGGATCTGAAGGTTTCATAAGG - Intronic
1017862746 6:158414239-158414261 CAGGCTCTGAAGGAGCCTGAAGG - Intronic
1018122640 6:160651174-160651196 CAGGTTCTGCAGGGCTTTGAAGG - Intronic
1018730539 6:166646709-166646731 TAGGAACTGAAGGGGGCTTAGGG - Intronic
1020711557 7:11612326-11612348 CAGGAGATGAAGAGGTCTCATGG + Intronic
1022517720 7:30986691-30986713 CAGGATGAGAAGGGGACTGAGGG + Intronic
1026581753 7:71624279-71624301 TAGGATCTGAAAAGGTCTCAGGG + Intronic
1028253468 7:88563254-88563276 CAGGATCTGAAGGTTTCATATGG + Intergenic
1028716420 7:93976281-93976303 CTGGATGTGAAGGGGTTGGAGGG - Intronic
1032257196 7:130306594-130306616 CAGGCTTTGAAGGGCTCAGAGGG + Intronic
1032467985 7:132158764-132158786 CAGGATCTGAAGAGGCCAGTGGG - Intronic
1033992509 7:147305832-147305854 CAGGATCCTGAGGTGTCTGAAGG + Intronic
1034274528 7:149818207-149818229 CAGTATCTGAGGGGTTTTGAGGG + Intergenic
1034277326 7:149829583-149829605 CAGGAGGTGGAGGGGACTGAGGG - Intergenic
1034430294 7:151037923-151037945 CGGGACCAGAAAGGGTCTGAAGG - Intronic
1036470228 8:9046393-9046415 CAGGAACTGCAGAGGTCTCAGGG - Intronic
1037918220 8:22785614-22785636 CAGGGTGTGAAGGAGTCAGATGG + Intronic
1044804334 8:95989533-95989555 CAGGAACTGATGGGTCCTGAAGG - Intergenic
1045335729 8:101202636-101202658 CAGGACATGAAGGGGACTTATGG + Exonic
1048130976 8:131696981-131697003 GAGGATCTGAAGGGAGATGAGGG + Intergenic
1048607342 8:135983120-135983142 CAGGCTCTGATGAGGACTGAAGG + Intergenic
1048658402 8:136569677-136569699 CAGGATGTGAAGTGGTCTCAAGG + Intergenic
1049181573 8:141225795-141225817 CAGGCTCTGGAGGGGCCTGTGGG - Intronic
1049689178 8:143951275-143951297 AAGGATCTGAAGGGGGGTGCTGG + Intronic
1049773242 8:144393360-144393382 CAGGATCTGCAGGGGATGGAAGG + Exonic
1051041907 9:12821649-12821671 CCAAGTCTGAAGGGGTCTGATGG - Exonic
1052287920 9:26807637-26807659 CAAGATCTGATGAGATCTGACGG - Intergenic
1053234948 9:36444982-36445004 CAGGATTTGTTTGGGTCTGAGGG - Intronic
1053420029 9:37971500-37971522 CAGGAGCTGGAGGGGTCCTATGG - Intronic
1056419590 9:86410589-86410611 CAGGATGTGCAGTGGTCTGGGGG + Intergenic
1057694990 9:97316912-97316934 CAGGGCCTGAAGGGGACTGAGGG - Intronic
1060261007 9:122073489-122073511 CATGCTATGATGGGGTCTGAAGG + Intronic
1060608488 9:124940022-124940044 GAGGATCTGAAGTGGTAAGATGG - Intronic
1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG + Intronic
1061278869 9:129585651-129585673 TAGGATCTGAAGAGGCCTGGTGG - Intergenic
1061520505 9:131114780-131114802 AAGGGTCTGGAGGAGTCTGAGGG - Intronic
1062357298 9:136170905-136170927 CAGGATCTGCAGGGGTCCCAGGG - Intergenic
1185911954 X:3989672-3989694 CAGGATGTGAATGGGTTTTACGG - Intergenic
1188896455 X:35674650-35674672 CAGGATATGAAGGGGTTTATGGG + Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1195016664 X:100787960-100787982 GAGGATGGGAAGGGGTATGAAGG + Intergenic
1195336740 X:103862342-103862364 CAGTATCTGCAGTGTTCTGAAGG - Intergenic
1196851477 X:119943017-119943039 CACTATATGAAGGGGCCTGAGGG + Intronic