ID: 1132176147

View in Genome Browser
Species Human (GRCh38)
Location 15:99716760-99716782
Sequence CTGTTGCATGCACAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132176145_1132176147 -7 Left 1132176145 15:99716744-99716766 CCGGGGCCTAATCTGGCTGTTGC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258
1132176143_1132176147 -3 Left 1132176143 15:99716740-99716762 CCCACCGGGGCCTAATCTGGCTG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258
1132176137_1132176147 23 Left 1132176137 15:99716714-99716736 CCATAGGAAGCAGTGGGCCACGC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258
1132176136_1132176147 24 Left 1132176136 15:99716713-99716735 CCCATAGGAAGCAGTGGGCCACG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258
1132176144_1132176147 -4 Left 1132176144 15:99716741-99716763 CCACCGGGGCCTAATCTGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258
1132176141_1132176147 6 Left 1132176141 15:99716731-99716753 CCACGCAGTCCCACCGGGGCCTA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG 0: 1
1: 0
2: 1
3: 28
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132176147 Original CRISPR CTGTTGCATGCACAGTGCTG TGG Intronic
900700612 1:4046614-4046636 CTCTTCCATGCACACTGATGAGG + Intergenic
900714769 1:4137231-4137253 CTGGAGCATGCACTGTGCAGTGG + Intergenic
901153101 1:7117456-7117478 CTGGTGAATGCTCAGTGGTGGGG + Intronic
901759617 1:11462200-11462222 CTGTTGTATACAAAGTCCTGTGG - Intergenic
905290560 1:36919115-36919137 CTGGTGCCTTCTCAGTGCTGGGG + Intronic
910057024 1:83045471-83045493 ATGTTCCATGCACAGTGATATGG - Intergenic
910382951 1:86649534-86649556 ATGTTGCAAGCACTGTGCTTAGG + Intergenic
912529295 1:110308504-110308526 CTACTGCATACAAAGTGCTGTGG + Intergenic
912565220 1:110582695-110582717 CTGCTGCATGCACAGGGTGGGGG + Intergenic
912654059 1:111469866-111469888 CAGTTGGATGCACAGATCTGGGG - Intergenic
913343768 1:117787233-117787255 CTGTTGAATGAGCAGTGATGAGG - Intergenic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
917479055 1:175394886-175394908 CACATGCATGCACAGTGATGAGG - Intronic
918379147 1:183937232-183937254 ATGGTGCATGGACAGTGATGAGG + Exonic
919048026 1:192478196-192478218 TTGTTGTAGGCACAGTGCTTTGG + Intergenic
920536222 1:206738208-206738230 CTGTGTCATGCCCAGTGCTTAGG + Intergenic
921885827 1:220304258-220304280 CTGGAGGATACACAGTGCTGGGG + Intergenic
922335473 1:224615816-224615838 CTGTAGCATACTCAGTGCTTAGG - Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
1062974513 10:1673704-1673726 CTGCTGCATGGACAGGGCTCAGG + Intronic
1064183533 10:13140660-13140682 CATTTGCATGCACAGGTCTGGGG - Intergenic
1064189400 10:13192493-13192515 CTGTTGCTTCAAGAGTGCTGAGG - Exonic
1064943661 10:20763100-20763122 CTGTTCCAGCCACAGTGCTTTGG - Intergenic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1070380654 10:75877935-75877957 CTGTTGCATGCCCTGTGAGGGGG - Intronic
1071234058 10:83623752-83623774 CTGTTGTGTGCTCAGTGCTGGGG - Intergenic
1071542043 10:86494275-86494297 CTGCTGCATGCAAAGTACAGTGG + Intronic
1072440082 10:95446672-95446694 CTACTGCATGTCCAGTGCTGAGG - Intronic
1072531605 10:96324661-96324683 CTGTGTCAGACACAGTGCTGAGG - Intronic
1072581499 10:96744013-96744035 ATGATGCAGCCACAGTGCTGTGG - Intergenic
1073224163 10:101902645-101902667 CTGTTGCAGACAAAGAGCTGTGG - Intronic
1074003276 10:109393468-109393490 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1075528280 10:123203990-123204012 CTGGTGAGTGCCCAGTGCTGTGG - Intergenic
1076360755 10:129887153-129887175 CTGTTGCAGGCCCAGGGCTGAGG - Intronic
1076458815 10:130624086-130624108 CTGGTGCATGCACTGGGCAGAGG - Intergenic
1076811600 10:132889120-132889142 CTGTGGCCTGCAGAGTGCTGGGG - Intronic
1076845557 10:133067922-133067944 CTGTGGCCAGCACAGTGCTGGGG - Intergenic
1078018022 11:7632066-7632088 CTGCTGAAGGCACAGTGTTGTGG + Intronic
1078656610 11:13246490-13246512 CTAGTGCATGCACATAGCTGCGG - Intergenic
1080121486 11:28683099-28683121 CTATTGCAGGCACAGTTCTAGGG + Intergenic
1080678626 11:34452021-34452043 TTCTTGGATGCAAAGTGCTGTGG + Intronic
1082559383 11:54600722-54600744 GTGTTGCCTTCACAGAGCTGAGG - Intergenic
1083761819 11:64822849-64822871 CAGAAGCATGCACAGTGCTAAGG - Intergenic
1086171436 11:83841032-83841054 CTTTTGCATGCATACTGCTGAGG + Intronic
1088257807 11:107917168-107917190 CTGTTGCATGCCCTGTGAGGGGG + Intronic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089872997 11:121693414-121693436 CTATACAATGCACAGTGCTGGGG - Intergenic
1091798807 12:3311865-3311887 CTGGTGCATGCTCAGTGTAGAGG + Intergenic
1094207430 12:27855193-27855215 CTGTTGCAGCTACAGAGCTGAGG + Intergenic
1098396739 12:70027340-70027362 CTGGTCCATGGAGAGTGCTGGGG + Intergenic
1100927769 12:99569296-99569318 CTGCTTCATGAAAAGTGCTGGGG + Intronic
1101549359 12:105747716-105747738 CCATTGCATCCCCAGTGCTGGGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103943601 12:124514011-124514033 CTGCTACATACCCAGTGCTGGGG + Intronic
1106272291 13:28166535-28166557 CTGGTGGCTGCACAGTTCTGAGG + Intronic
1106889193 13:34225123-34225145 CTGGAGCATGCACAATGCAGCGG - Intergenic
1108160329 13:47632318-47632340 CTGTGGTTTGCACAGTTCTGTGG - Intergenic
1108297354 13:49037689-49037711 CTGTTGCATGTACTGTGAGGGGG - Intronic
1108914884 13:55595545-55595567 CTGTCGCATGAACCGTGCAGTGG + Intergenic
1109410735 13:61964398-61964420 ATTTTTCCTGCACAGTGCTGAGG - Intergenic
1109999010 13:70169701-70169723 CTGTTGAATGCATACTCCTGTGG + Intergenic
1110385171 13:74902493-74902515 GTGATGCATCCACAGGGCTGAGG + Intergenic
1113401138 13:109994345-109994367 CTAATGCCTGCACAGTGGTGAGG - Intergenic
1113731416 13:112644354-112644376 CTGATGCATACTCAGGGCTGTGG - Intergenic
1113971545 13:114195111-114195133 CTGCAGCATGCCCAGGGCTGTGG - Intergenic
1114142760 14:19934180-19934202 CTGTTGGATACACAGAGCTAAGG + Intergenic
1114998600 14:28392356-28392378 TTGTTGCTTGCATAGTTCTGAGG + Intergenic
1115312875 14:31996814-31996836 CTTTTGCATTCACCGTGCTTTGG - Intergenic
1115800691 14:36990307-36990329 CAGTTGCATGGAGAGAGCTGGGG - Intronic
1117491186 14:56249593-56249615 CTGGAGCATGCTCAGTACTGGGG - Intronic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1121754922 14:96394230-96394252 TTTTTGTATGCACAGTGCTAGGG + Intronic
1122318142 14:100837617-100837639 CTGATGCGTGCACATGGCTGAGG - Intergenic
1123886697 15:24733816-24733838 CTGTTGCATGGACAGAGCAGTGG - Intergenic
1124442661 15:29698669-29698691 CTGCACCATGCTCAGTGCTGTGG + Intergenic
1125087666 15:35749475-35749497 CTGTTGCTTGCACATATCTGGGG - Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1130065835 15:80604379-80604401 CTGCTCCATGAACAGTGCTGGGG + Intergenic
1130937517 15:88482796-88482818 GGGTGGCGTGCACAGTGCTGGGG + Intergenic
1131399216 15:92111101-92111123 CTGTGGGAAGCACAGTGGTGGGG - Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1132463630 16:67721-67743 CTGCTGCCTCCACAGTGCTCAGG + Intronic
1132751072 16:1457979-1458001 CCCTTGCCTGCTCAGTGCTGAGG - Intronic
1133039765 16:3054327-3054349 CAGATGCATGCACAGAGGTGGGG + Intronic
1133039817 16:3054667-3054689 CAGATGCATGCACAGAGGTGGGG + Intronic
1133273916 16:4625305-4625327 CTGTTGCAAGGACGGAGCTGAGG - Intronic
1133472070 16:6085069-6085091 CTGTCTCAGGCAGAGTGCTGGGG + Intronic
1133721093 16:8495108-8495130 CTGTTCCATTCTAAGTGCTGCGG + Intergenic
1133808960 16:9146564-9146586 CTGGAGCATGCACAGTGATCCGG + Intergenic
1134430556 16:14200745-14200767 TTGTTGCCTGTCCAGTGCTGTGG + Intronic
1135824732 16:25716665-25716687 CTGTTCCAGGCATCGTGCTGAGG + Intronic
1139721499 16:68859675-68859697 CAATTACATGCAAAGTGCTGTGG + Intronic
1140213584 16:72989907-72989929 ATGTTTCATGCACAGGCCTGGGG + Intronic
1141220616 16:82066014-82066036 CTTCTGGATCCACAGTGCTGAGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142767001 17:2070454-2070476 CAGATGCAGGCACAGGGCTGGGG + Intronic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1144722553 17:17481737-17481759 CTATTACCAGCACAGTGCTGGGG + Intronic
1145713925 17:27001522-27001544 CTGTTGCATTCACAGAGCACAGG + Intergenic
1145961550 17:28889139-28889161 CTGTTGGGTGCCTAGTGCTGAGG + Intronic
1146461522 17:33049787-33049809 CTGTTTTATGCAAAATGCTGCGG - Intronic
1146520953 17:33525153-33525175 CTGTTCCATGCACATGACTGAGG - Intronic
1146922005 17:36719832-36719854 CTGTTCCAAGCACTGTACTGAGG - Intergenic
1147265435 17:39231717-39231739 CTGTTGGAAGCACAGGGGTGGGG - Intergenic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148695477 17:49555818-49555840 CTGGTGCATGCCCAGGGCAGGGG - Intergenic
1149234996 17:54578847-54578869 TTGTGGGAGGCACAGTGCTGTGG + Intergenic
1149434034 17:56618316-56618338 CTGTTCCTTGCACATTGCTCTGG + Intergenic
1151331404 17:73411367-73411389 TTGTGGCAAGCACAGTGCAGAGG + Intronic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155847730 18:30730925-30730947 CTGTGGGTTGCACAGTTCTGCGG - Intergenic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1158535675 18:58306229-58306251 CTGGAGCATGCACAGCTCTGGGG - Intronic
1160891628 19:1381683-1381705 CTGATGCCTGCACAGTTCTGAGG - Intergenic
1161104866 19:2438328-2438350 CTGTTGCATATACCCTGCTGGGG + Intronic
1162779563 19:12999899-12999921 CTGATTCATGCCCACTGCTGGGG + Intronic
1163728060 19:18933530-18933552 CTGCTGCCTGCACTGGGCTGCGG - Intronic
1163772045 19:19197180-19197202 CTGGTGGATGGACAGGGCTGGGG - Exonic
1164630565 19:29759175-29759197 CAGTTGCCTGCACACAGCTGGGG - Intergenic
1165856212 19:38880577-38880599 CTGAGGAATGCAAAGTGCTGGGG + Intronic
1167204404 19:48090794-48090816 CTGGTCCATGCACACTGCTGGGG + Intronic
1168477571 19:56687970-56687992 CTGTTTCACGCACAGTCATGTGG - Intergenic
925148635 2:1599893-1599915 GTGTGGCATGCACAGAGCTGCGG - Intergenic
925778708 2:7359598-7359620 CTATTGCTAGCACAGAGCTGTGG + Intergenic
926245539 2:11120262-11120284 CTCTTGCCTGCCCAGTCCTGGGG + Intergenic
926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG + Intronic
927333696 2:21895765-21895787 CTGGTGCTTGCCCAGAGCTGAGG - Intergenic
927459887 2:23289323-23289345 GTGTTGCATTCAAAGTACTGTGG - Intergenic
929444062 2:41989090-41989112 CTGTTGGATGCTCATTGGTGGGG - Intergenic
931240277 2:60446185-60446207 CAGTTGCTTGTACAGTGCTCAGG - Intergenic
932891093 2:75598049-75598071 CTGTTGGATGCAAAGGGCAGGGG - Intergenic
932982311 2:76684654-76684676 ATGTTGTATGGACACTGCTGGGG + Intergenic
937872305 2:126794634-126794656 CTGTTGCCTGGAAAGTGCTGGGG - Intergenic
937931434 2:127208356-127208378 CTGTAGGTTGCACAGTTCTGTGG - Intronic
940270858 2:151888524-151888546 GTGTTTCAGGCAGAGTGCTGTGG - Intronic
940581288 2:155584147-155584169 GGGCTGCATCCACAGTGCTGAGG + Intergenic
941004956 2:160238392-160238414 CTGTTTCCAGGACAGTGCTGCGG + Intronic
942365807 2:175226093-175226115 GTGTTGCATCAACAGTGCTCAGG - Intergenic
942383805 2:175420735-175420757 CTGGTGTACGCACGGTGCTGTGG - Intergenic
942924004 2:181411081-181411103 CTGTGGGCTGCACAGTTCTGTGG - Intergenic
943442024 2:187936705-187936727 CCATTACATGCTCAGTGCTGAGG + Intergenic
944328163 2:198432003-198432025 CTGTTGAATGCCTAGTGCTATGG - Intronic
947375323 2:229489591-229489613 CTGGTGCAGGCAAAGTGCTGAGG + Intronic
948795810 2:240401591-240401613 CTGTGAGATGCACAGGGCTGTGG - Intergenic
949035463 2:241814006-241814028 CTGTGGCTTCCACGGTGCTGTGG + Intronic
1170181522 20:13535658-13535680 CTGTTGCATTCAGTGTGATGTGG - Intronic
1170566632 20:17611516-17611538 CTTCTGCATGCACAGACCTGGGG + Intergenic
1171106001 20:22432987-22433009 CGGTTGCATCCAGAGTCCTGAGG - Intergenic
1171384151 20:24756404-24756426 CTGTTGCATGCCCTGTGAGGGGG - Intergenic
1173667830 20:44775318-44775340 CTGTAGCATGCTATGTGCTGTGG + Intronic
1173797535 20:45872803-45872825 CTATTGTGTGCACAGTGCGGGGG - Intronic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1175456503 20:59119054-59119076 CTGTTGGAAACACAGTGTTGGGG + Intergenic
1182076154 22:27496778-27496800 CTGTTTCTTGCACAGTGCCTGGG + Intergenic
1183321282 22:37166599-37166621 CTTTTGCATGCAAAGTCCCGAGG - Intronic
1183573159 22:38669435-38669457 CTTCTGCATGCCCAGTGCTTAGG - Intronic
1184418483 22:44365500-44365522 GTGATGCTTGCAAAGTGCTGCGG - Intergenic
1184516670 22:44966488-44966510 CTCTTGCATCTCCAGTGCTGGGG - Intronic
949503703 3:4706234-4706256 CTGTTTTCTGCACAATGCTGTGG - Exonic
950151885 3:10693921-10693943 CTGTTGCAGGCACCATGCAGTGG + Intronic
950853365 3:16083448-16083470 CTGTGGCATGCAAAGGTCTGAGG - Intergenic
953200824 3:40777173-40777195 CTGTTGAATGAAGAGTGGTGAGG - Intergenic
954105893 3:48409802-48409824 CTCGTGCAGGCACAGTGCCGGGG - Intronic
954290949 3:49649781-49649803 CTGTTTCAGGCCCAGTGCTGGGG - Intronic
954541524 3:51396023-51396045 CTGTTGCAGGCACACTGCAGTGG + Exonic
954994761 3:54871434-54871456 CTGTTTCATGGACAGGGCTTGGG - Intronic
955066336 3:55536458-55536480 CTGTATCAGGCACAGTGCTAGGG - Intronic
956121467 3:65970453-65970475 CTTTTGCATGTACACTTCTGTGG - Intronic
956447443 3:69339462-69339484 CTGTTGCCTTCTCAGTTCTGTGG - Intronic
957338641 3:78863969-78863991 CTGTTGCCTGTAAAGTGCTAAGG + Intronic
960236164 3:115285214-115285236 CTGCTGCAGCCAGAGTGCTGTGG - Intergenic
960988613 3:123296200-123296222 TGGTTGCATGCTCAGGGCTGTGG + Exonic
961000877 3:123373126-123373148 CTGCTGCATGCTAGGTGCTGTGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961642934 3:128376169-128376191 CTGGGGCATGCACAGTTCTCTGG + Intronic
963294432 3:143530068-143530090 TTGTAGCATGCACTGTACTGAGG + Intronic
964074371 3:152675567-152675589 ATGTTGAATGCTGAGTGCTGAGG - Intergenic
964384434 3:156132092-156132114 CTGTTTCAAGCACAGCTCTGTGG - Intronic
966317925 3:178669561-178669583 GTGTTGCATACACATTGGTGAGG - Intronic
967336008 3:188345475-188345497 CTGTTTCCTGCACATTGTTGGGG + Intronic
967412180 3:189178049-189178071 CTGCTGCATGCTCAGTTCTCAGG - Intronic
967778351 3:193407917-193407939 CAGCTGGATGCACAGTCCTGAGG - Intronic
969038838 4:4277755-4277777 CAGTTGCATCCACAGTGATCAGG + Intronic
969176002 4:5399550-5399572 CTGGGGCATGGACAGAGCTGAGG + Intronic
969968606 4:11022759-11022781 CTGCTGGATGCACAGGGCAGAGG - Intergenic
970127109 4:12827187-12827209 TTGTTTCATGCCCAGTGCTATGG + Intergenic
972920477 4:43934399-43934421 CTGTTGCAGGCCAGGTGCTGTGG + Intergenic
975989825 4:80247176-80247198 CAGTTCCATGCACATTGCTAGGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
982394681 4:154903554-154903576 CTCTTGCATGCACAGAGCCTTGG + Intergenic
983762316 4:171426071-171426093 CTGTTGGATGAACAGTCCTGTGG + Intergenic
983918395 4:173316539-173316561 CTGTGGCATGCCCATTACTGGGG + Intronic
983972340 4:173890279-173890301 CTGTAGGTTGCACAGTTCTGTGG + Intergenic
985220478 4:187698177-187698199 CTGATGCTTGCACAGTCCTTTGG + Intergenic
986028211 5:3871003-3871025 CTGTTGCATGCAGAGGCCTGGGG - Intergenic
987218859 5:15768786-15768808 CTGTTGCCTGCACAGCACTGTGG - Intronic
990200398 5:53366391-53366413 CTGTTGCCTGTACAGAGATGTGG + Intergenic
991439217 5:66628902-66628924 CTATTGCAGGGACATTGCTGAGG - Intronic
992320720 5:75611371-75611393 GTGTGGCGTGCACAGTGCTAAGG - Intergenic
992986340 5:82234345-82234367 CTGATACCTGCTCAGTGCTGAGG - Intronic
994282640 5:97924196-97924218 CTGTGACAAGCACAGTGCTTGGG + Intergenic
994831058 5:104784689-104784711 CATCTGCATGGACAGTGCTGGGG - Intergenic
997196485 5:131983693-131983715 CTGTTGCCTGGGCAGAGCTGGGG - Intronic
997409323 5:133679139-133679161 ATGTTGCATGCATGTTGCTGAGG - Intergenic
997697293 5:135871741-135871763 CTGTGGCCTGCACAGGGGTGCGG - Intronic
1002071854 5:176683353-176683375 TTGTTGCAAGCAGAGTCCTGGGG - Intergenic
1002348666 5:178566331-178566353 CTTTGGGATGGACAGTGCTGTGG - Intronic
1003053229 6:2798287-2798309 CTGCTGCATGCCCGGTGATGTGG + Intergenic
1003084284 6:3049095-3049117 CTGTGGCCTGCACAGTGGTCAGG + Intergenic
1004522084 6:16371591-16371613 CTGTTGCATCTAGAGTGCAGTGG + Intronic
1004561668 6:16758844-16758866 CTGATGCATGCACAGTGAGAGGG + Intronic
1004760024 6:18656379-18656401 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1004797439 6:19103319-19103341 GTGGTGCATGCAGAGTGCTGAGG - Intergenic
1007103779 6:39269313-39269335 CTGTTTCCTACACAGTGCAGGGG - Intergenic
1008837226 6:55849153-55849175 GTGTTTCAGGCACACTGCTGTGG + Intronic
1011945151 6:92891037-92891059 CTGGTGCCAGCCCAGTGCTGGGG + Intergenic
1012858722 6:104533509-104533531 CTGGTGCATGAGGAGTGCTGAGG - Intergenic
1014122423 6:117740454-117740476 CTGGTGCATGTACACTGCTGTGG - Intergenic
1016349875 6:143155557-143155579 GTGTTACAAGCACAGTGTTGTGG + Intronic
1018792303 6:167157786-167157808 CTGTGGCCACCACAGTGCTGGGG + Exonic
1020746648 7:12087818-12087840 CTGTTATATGGACAGTGCTTTGG + Intergenic
1021667654 7:23002273-23002295 CTTTTACATGCCCATTGCTGTGG - Intronic
1021940511 7:25674286-25674308 CTTTGGCATGCACAGTGCCAGGG - Intergenic
1022291033 7:29003732-29003754 TTTTTCCATGCACAGTGTTGGGG + Intronic
1022516771 7:30979870-30979892 CTCTTAAAAGCACAGTGCTGAGG - Intronic
1022654653 7:32307609-32307631 CTGCTGCATGCCCAGGACTGAGG + Intergenic
1023022406 7:36021990-36022012 GTGTTCCCAGCACAGTGCTGAGG - Intergenic
1023538098 7:41235483-41235505 CTGTTGCATGAAAAATGCAGTGG - Intergenic
1023576639 7:41635293-41635315 CTGTTGCAGGCACTACGCTGAGG - Intergenic
1024084373 7:45881409-45881431 CTGTTGCATGCTCAAGTCTGAGG - Intergenic
1024597552 7:50952876-50952898 CTGGTCCATGCACAGTTCTATGG + Intergenic
1026523612 7:71136334-71136356 CTCTTACATGCACAGTGCACTGG - Intronic
1026642674 7:72140816-72140838 CTCTCTCATGCACAGTCCTGGGG + Intronic
1027569621 7:79847589-79847611 CTGTTGCATGCCCTGCGCGGGGG + Intergenic
1028056582 7:86252659-86252681 ATGTGGCCAGCACAGTGCTGGGG - Intergenic
1028388292 7:90285206-90285228 CTGCTGGAGGCCCAGTGCTGGGG - Intronic
1029982379 7:104890925-104890947 CTGTTGCAGGCACGAGGCTGGGG - Intronic
1031950602 7:127887893-127887915 CTGTTGCAGAAACATTGCTGAGG + Exonic
1035753315 8:2010807-2010829 CAGTTGAATGCACACAGCTGCGG + Intergenic
1036130092 8:6102090-6102112 CTGCTCCATGCCTAGTGCTGTGG + Intergenic
1036642333 8:10592185-10592207 CTGCAGCATTCACAGGGCTGGGG + Intergenic
1037608335 8:20456020-20456042 CTACTGCATGCAGAGGGCTGAGG - Intergenic
1037797854 8:22011142-22011164 CTCTTGCAGGCAGAGCGCTGGGG + Intergenic
1037827935 8:22170377-22170399 GTGTTGCATGCTCTGTGCTGGGG + Intronic
1038226873 8:25665826-25665848 CTGTTGCATGCAGATTTCTGTGG + Intergenic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1039388578 8:37158703-37158725 CTGTTGCCTCCCCAGTGTTGTGG - Intergenic
1040011125 8:42661896-42661918 CTGCTCCCTGCACAGAGCTGGGG - Intergenic
1042114262 8:65414202-65414224 CTGTTGGATTCCCAGGGCTGAGG + Intergenic
1046841890 8:118868243-118868265 CAGTTGCAGGCACAGTCCTGGGG + Intergenic
1047424155 8:124730168-124730190 CTGTCCCAGGCACATTGCTGAGG + Intergenic
1047772884 8:128044581-128044603 GTGTTGCAGGCACTGTGCTGAGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048643428 8:136389828-136389850 ATGTGTCATGCACAGTGCTAGGG + Intergenic
1050607245 9:7314681-7314703 CTCTTCTCTGCACAGTGCTGAGG - Intergenic
1051552584 9:18346540-18346562 CTGTTCCAGGCACAGTGCTAGGG - Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052762531 9:32607338-32607360 CTGTGGCCTGCGCAGTGCTCAGG + Intergenic
1053607792 9:39678840-39678862 ATGCTGCTTTCACAGTGCTGAGG + Intergenic
1053865640 9:42435200-42435222 ATGCTGCTTTCACAGTGCTGAGG + Intergenic
1054245743 9:62663569-62663591 ATGCTGCTTTCACAGTGCTGAGG - Intergenic
1054559868 9:66698100-66698122 ATGCTGCTTTCACAGTGCTGAGG - Intergenic
1057575186 9:96236784-96236806 CTGTGTCTTGCACAGTTCTGGGG + Intronic
1059770417 9:117418550-117418572 AAGTTGCATGCAAAGGGCTGAGG - Intergenic
1060094640 9:120777106-120777128 CTGTTGCCTAGACATTGCTGAGG - Intronic
1060321182 9:122562476-122562498 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1060766531 9:126298274-126298296 CTGCTGCAAACACAGGGCTGGGG - Intergenic
1060797086 9:126520076-126520098 CTGTTGAATGCAAAGGTCTGTGG + Intergenic
1061282126 9:129603390-129603412 CTATTTCAGGCACTGTGCTGTGG - Intergenic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1187097334 X:16162261-16162283 CTGTTGCATGCCCTGTGAGGGGG + Intergenic
1187190035 X:17025701-17025723 ATGTAGCATGCACAGTTGTGGGG + Intronic
1190117296 X:47634604-47634626 CCCTTGCATGCCCAGTGATGTGG + Intergenic
1192951873 X:76026114-76026136 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1194058270 X:89164129-89164151 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1195979427 X:110561566-110561588 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1197922984 X:131615281-131615303 CGTTTGCATGCTCTGTGCTGTGG + Intergenic
1198311672 X:135430844-135430866 CTGTGGCAAGCACAGTGCTAGGG + Intergenic
1199690339 X:150304821-150304843 CAGGTGCATGCATGGTGCTGTGG - Intergenic
1200938715 Y:8760882-8760904 CTAGTGCATGCACATTCCTGAGG + Intergenic
1201345756 Y:12982856-12982878 CTGCAGCAGGCACAGAGCTGGGG - Intergenic
1201526415 Y:14940067-14940089 CTATCTTATGCACAGTGCTGAGG - Intergenic
1201685241 Y:16694122-16694144 CTTTGGCATGCTGAGTGCTGTGG - Intergenic
1201785604 Y:17774602-17774624 TTGTGGCATGCCCAGTTCTGTGG - Intergenic
1201815949 Y:18131386-18131408 TTGTGGCATGCCCAGTTCTGTGG + Intergenic