ID: 1132177830

View in Genome Browser
Species Human (GRCh38)
Location 15:99729221-99729243
Sequence CCATTGCCATCGAGCCATTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132177824_1132177830 -9 Left 1132177824 15:99729207-99729229 CCCTGGAACTGTACCCATTGCCA 0: 1
1: 0
2: 1
3: 12
4: 129
Right 1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG 0: 1
1: 0
2: 0
3: 5
4: 58
1132177825_1132177830 -10 Left 1132177825 15:99729208-99729230 CCTGGAACTGTACCCATTGCCAT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132177830 Original CRISPR CCATTGCCATCGAGCCATTG GGG Exonic
900611606 1:3546762-3546784 CCATTGCCACCCCGCCATGGTGG - Intronic
902141793 1:14362942-14362964 CCTTTGCCATCATGCCATTGGGG - Intergenic
910814802 1:91280430-91280452 CAATTGCCATGGTGCCATGGTGG - Intronic
911502426 1:98704750-98704772 CCATTTCTATGGAGACATTGGGG + Intronic
912803978 1:112741610-112741632 CCCTTGCCCTTGAGCCCTTGCGG - Intergenic
913594518 1:120360584-120360606 CCCTTTCCTTCGAGCGATTGTGG - Intergenic
919568587 1:199219175-199219197 CCATTCCCCTGGAGCCACTGGGG + Intergenic
921776859 1:219111689-219111711 CCATTCCCCTGGAGCCACTGGGG - Intergenic
1063819507 10:9818972-9818994 CCATTACCCTGGAGTCATTGGGG - Intergenic
1065791221 10:29262621-29262643 CCGTTGCCATGGTGCCATTTTGG + Intergenic
1070606579 10:77902557-77902579 CCATTAAAAACGAGCCATTGAGG + Intronic
1071736118 10:88303069-88303091 CCATTCCCCTGGAGCCACTGTGG - Intronic
1076454031 10:130576903-130576925 TAACTGCCATCGAGCCACTGAGG - Intergenic
1077326274 11:1965407-1965429 CCGTGGGCATCGAGGCATTGAGG + Intronic
1084214207 11:67638887-67638909 CCATTGCCATGGACCCAGGGGGG - Intronic
1086086978 11:82965692-82965714 CCATTCCTCTGGAGCCATTGTGG + Intronic
1086879622 11:92138146-92138168 CCATTGCCATCCACCCAGTGGGG + Intergenic
1088428908 11:109735675-109735697 CCATAGCCATGGATCCCTTGGGG + Intergenic
1090493065 11:127182879-127182901 TCATTGCCATCTTCCCATTGGGG - Intergenic
1202809255 11_KI270721v1_random:20586-20608 CCGTGGGCATCGAGGCATTGAGG + Intergenic
1114658535 14:24330496-24330518 CCACAGCCATCCAGCCCTTGGGG - Intronic
1117276232 14:54196740-54196762 CCATTGTCTTGGAGCTATTGAGG - Intergenic
1132177830 15:99729221-99729243 CCATTGCCATCGAGCCATTGGGG + Exonic
1137344622 16:47644780-47644802 CCAGTGCCAAAAAGCCATTGAGG + Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1144849748 17:18238079-18238101 CCATGGCCAGGGAGTCATTGGGG - Exonic
1146767394 17:35535693-35535715 CCACTGCCTTCGAGCCTTGGCGG - Intronic
1148779298 17:50112551-50112573 CCATTGCCCTCAGGCCATCGTGG - Intronic
1167804263 19:51768898-51768920 CCATGGCCATGGAGACAATGAGG - Exonic
932551318 2:72772496-72772518 CCATTGCCAGTTAGTCATTGTGG + Intronic
933474477 2:82771598-82771620 CCATTGCCGGGGAGCCAGTGTGG - Intergenic
1169017467 20:2303642-2303664 CCATGGCCACCGAGCCAGAGTGG + Intronic
1169764333 20:9132785-9132807 CCATTGCCCTAGAGGCAGTGAGG - Intronic
1181171009 22:21010077-21010099 CCATTGCCATGGATCAAGTGGGG + Intronic
1183785730 22:40028127-40028149 CCTTGGCCATGGAGCCCTTGGGG + Intronic
962224641 3:133595777-133595799 CCATTACCATGGTGCCACTGAGG - Intergenic
964167790 3:153729700-153729722 CCAATTCCATCGAACCAGTGTGG + Intergenic
969097336 4:4743558-4743580 CCATAGCCATGGAGCCCATGGGG + Intergenic
974240438 4:59238749-59238771 CCATTCCCCTGGAGTCATTGGGG + Intergenic
984077793 4:175205291-175205313 CCATTGCCATGGCAACATTGAGG - Intergenic
985893402 5:2733903-2733925 GCATTGCCCTGGAGCCAATGAGG + Intergenic
988200763 5:28066172-28066194 CCATTCCCCTTGAGCCACTGGGG - Intergenic
988728158 5:33944099-33944121 CCCTTGCCACCGAGGCATAGAGG + Intergenic
989677340 5:43987013-43987035 CCATGGCCATCTTGCCTTTGAGG + Intergenic
995456304 5:112356168-112356190 CCATCGTCAGGGAGCCATTGTGG - Intronic
1006020787 6:31116496-31116518 CCATTGCATTCCAGCCAGTGGGG - Exonic
1009497784 6:64373090-64373112 CCATTGCTAGGGAGCTATTGTGG + Intronic
1010547219 6:77173178-77173200 CCATTGCCTCAGAGCTATTGTGG + Intergenic
1011680263 6:89776419-89776441 CCATTGCACTCGCGCCATTTGGG + Intronic
1016941594 6:149486835-149486857 CCAATGCCATCGAGCTTTTGTGG - Intergenic
1017723269 6:157259040-157259062 CCATTACCCTGGAGCCACTGCGG + Intergenic
1017893446 6:158658456-158658478 CCAACGCCATCAAGCCAGTGGGG + Intronic
1029603079 7:101581340-101581362 CCATTGCCATGTATCCATTGTGG - Intergenic
1037403246 8:18515147-18515169 CCATTGCCAATGAGGCAGTGAGG - Intergenic
1045775439 8:105797116-105797138 CCCTTGCCATGGAGGCATTATGG + Intronic
1051932650 9:22405903-22405925 CCATTCCCAAGGAGCCATTTAGG - Intergenic
1060824405 9:126679748-126679770 CCATTCCCTTCATGCCATTGTGG + Intronic
1185776894 X:2810358-2810380 AATTTGCCATCGAGGCATTGAGG + Intronic
1190524180 X:51311476-51311498 CAATTCCCCTCAAGCCATTGTGG + Intergenic
1192509577 X:71713910-71713932 CCACTGGCATCAAGCCACTGGGG + Intergenic
1192517120 X:71767643-71767665 CCACTGGCATCAAGCCACTGGGG - Intergenic
1194465848 X:94234772-94234794 CTATTCCCCTGGAGCCATTGTGG - Intergenic
1195567976 X:106363988-106364010 CCAGTCCCCTGGAGCCATTGAGG + Intergenic
1201293104 Y:12441108-12441130 AATTTGCCATCGAGGCATTGAGG - Intergenic