ID: 1132178043

View in Genome Browser
Species Human (GRCh38)
Location 15:99731509-99731531
Sequence CCCTGGCCCCCAAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132178043_1132178050 -9 Left 1132178043 15:99731509-99731531 CCCTCCCTCTTTGGGGGCCAGGG 0: 1
1: 1
2: 0
3: 33
4: 287
Right 1132178050 15:99731523-99731545 GGGCCAGGGTTGGGAACTAAAGG 0: 1
1: 0
2: 1
3: 27
4: 230
1132178043_1132178057 27 Left 1132178043 15:99731509-99731531 CCCTCCCTCTTTGGGGGCCAGGG 0: 1
1: 1
2: 0
3: 33
4: 287
Right 1132178057 15:99731559-99731581 ATTCCAATTCTGGCTAAATAGGG 0: 1
1: 0
2: 1
3: 24
4: 156
1132178043_1132178056 26 Left 1132178043 15:99731509-99731531 CCCTCCCTCTTTGGGGGCCAGGG 0: 1
1: 1
2: 0
3: 33
4: 287
Right 1132178056 15:99731558-99731580 CATTCCAATTCTGGCTAAATAGG 0: 1
1: 0
2: 1
3: 14
4: 160
1132178043_1132178052 17 Left 1132178043 15:99731509-99731531 CCCTCCCTCTTTGGGGGCCAGGG 0: 1
1: 1
2: 0
3: 33
4: 287
Right 1132178052 15:99731549-99731571 TCCCACCTGCATTCCAATTCTGG 0: 1
1: 0
2: 3
3: 12
4: 168
1132178043_1132178058 28 Left 1132178043 15:99731509-99731531 CCCTCCCTCTTTGGGGGCCAGGG 0: 1
1: 1
2: 0
3: 33
4: 287
Right 1132178058 15:99731560-99731582 TTCCAATTCTGGCTAAATAGGGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132178043 Original CRISPR CCCTGGCCCCCAAAGAGGGA GGG (reversed) Intronic
900167648 1:1249957-1249979 CCTTGGCTGCCAAACAGGGAAGG - Intergenic
900389807 1:2428977-2428999 CCCTGGCCCCAGAAGATGGCAGG - Intronic
900460353 1:2799696-2799718 CCCTGGCCCCCTCAGTGGCAGGG + Intronic
900640259 1:3685040-3685062 CGCTGGACCCCAGGGAGGGAGGG + Intronic
901913582 1:12480342-12480364 CCCTGGCCTCCAAAAGGAGATGG - Intronic
903222602 1:21877170-21877192 CCCTGGCAGCCAAAGAGAAAAGG - Intronic
903708776 1:25306493-25306515 CCGGGGCCACCAAAGGGGGATGG - Intronic
904164446 1:28544682-28544704 CCTTGGCTACCAAACAGGGAAGG - Intergenic
905792761 1:40799047-40799069 CCCTGGCCAAGACAGAGGGAGGG - Intronic
905913074 1:41667050-41667072 CCCTGGCCCCCAGGGAGTGTTGG + Intronic
907311946 1:53543851-53543873 CCCTTGCCCAATAAGAGGGAAGG - Intronic
908274211 1:62452996-62453018 CACTGACCCCCAAAGAAGAAGGG + Intergenic
912547431 1:110460978-110461000 CCCTCGCCACCAAGGAGGAAGGG + Intergenic
912800415 1:112716381-112716403 CCCTGGCCCTAAGAGAAGGATGG - Intergenic
913585217 1:120268113-120268135 CCCTGGCCACCAAAAATAGATGG - Intergenic
913622968 1:120630249-120630271 CCCTGGCCACCAAAAATAGATGG + Intergenic
914567219 1:148879974-148879996 CCCTGGCCACCAAAAATAGATGG - Intronic
914605604 1:149250268-149250290 CCCTGGCCACCAAAAATAGATGG + Intergenic
915145720 1:153794940-153794962 CCCTGGCCTCTGAATAGGGAAGG - Intergenic
916608757 1:166369124-166369146 ACCTCTCCCCCAAAGAGGGGAGG + Intergenic
919290486 1:195623782-195623804 GCCTGGATCCCAAGGAGGGATGG + Intergenic
919570487 1:199242649-199242671 CCCTGCCCCCAAAAAAGGCAAGG + Intergenic
920672655 1:208016229-208016251 CCCTGAGCCCCAAAGAGCAACGG + Intergenic
922442485 1:225667555-225667577 CCTTGGCCACCAGAGAAGGATGG + Intergenic
1062990316 10:1808223-1808245 GCCTGGCGCCCACACAGGGATGG - Intergenic
1063262173 10:4401807-4401829 GCCTGGCCCCCAAACACAGATGG - Intergenic
1063381908 10:5590948-5590970 CCCTGGCCCCTGGAGCGGGAGGG - Intergenic
1063676063 10:8141389-8141411 CCCAGAGCCCCAAAGAGAGACGG - Intergenic
1067017941 10:42771698-42771720 CCCTGGCCCCCAAGGGTGCAAGG - Intergenic
1068963148 10:62885536-62885558 ACCTGACCCCAAAAAAGGGATGG - Intronic
1070580613 10:77716315-77716337 CCCTGGGCCCCAAGAAGTGAAGG + Intergenic
1070793429 10:79203166-79203188 TCCTGGCCCTCAAGGAGGGAAGG - Intronic
1070807196 10:79277595-79277617 CCCTGGTCAAGAAAGAGGGAAGG - Intronic
1071093721 10:81949318-81949340 ACCTTGCCCCAAAAGAGGTACGG - Intronic
1072534946 10:96355431-96355453 TCTTGGCCCCAAAAGAAGGAAGG + Intronic
1072650708 10:97292807-97292829 CCCTGGCGGAAAAAGAGGGAGGG + Intergenic
1073050281 10:100662653-100662675 CCCTGAAGCCCAGAGAGGGAAGG - Intergenic
1073101205 10:101007576-101007598 CCCTGTCCCCCAATGTGGGCAGG - Exonic
1073511376 10:104044763-104044785 CACGGGCCCTCAAAAAGGGAAGG + Intronic
1073928357 10:108544279-108544301 CCTTGGCTACCAAATAGGGAAGG - Intergenic
1076874260 10:133208189-133208211 GGCAGGCCCCCAGAGAGGGATGG + Intronic
1077405451 11:2380529-2380551 CACTGGCCCCCAAAGCGGTCAGG - Intronic
1077746656 11:4914555-4914577 CCCTGGCCACAACAGAGTGAGGG + Intronic
1079301986 11:19286345-19286367 ACCTGGCCCACAAGGTGGGAGGG + Intergenic
1079356103 11:19731325-19731347 CCCTGGCTCCCACAGTGGGAAGG + Intronic
1079407817 11:20160943-20160965 CCCTACCCCCACAAGAGGGAGGG - Intergenic
1080674142 11:34409223-34409245 CCCTGGCCCCACAACATGGATGG + Intergenic
1082086009 11:48050322-48050344 CCCTGGCCCCCACATATGCACGG + Intronic
1082954168 11:58851025-58851047 CCTTGGCTGCCAAACAGGGAAGG + Intronic
1083718188 11:64591090-64591112 CCCTGGCCCCCAAGCAGAGGAGG + Exonic
1083891537 11:65598159-65598181 TCCTGACCCCCAAAGGGGGGTGG + Exonic
1084133182 11:67153395-67153417 CCCTGGCTCCCAAAGAATGAGGG + Intronic
1085327221 11:75615909-75615931 GCCAGGCCCCAGAAGAGGGAGGG + Intronic
1086096284 11:83053083-83053105 CCCTGGGCTCCATAGATGGAAGG + Intronic
1089730597 11:120516529-120516551 CCCTGGCCACCAAACAGAGAAGG + Intronic
1090381797 11:126332550-126332572 CCCTGGCCCAGAAGAAGGGAGGG + Intronic
1090423813 11:126593422-126593444 CCCTGGTCCCCACAGTGGGTAGG - Intronic
1092058131 12:5523851-5523873 CCCTGGACCCATAAGAGGGAGGG + Intergenic
1092490493 12:8940605-8940627 CACTGGACACAAAAGAGGGATGG - Exonic
1093281719 12:17203804-17203826 TCCTGGGCCCCCAAGAGGGCAGG - Intergenic
1094848880 12:34373513-34373535 CCCTGGCCCCCAAGCATGCACGG + Intergenic
1096945996 12:55410553-55410575 CACTGGACACAAAAGAGGGATGG + Intergenic
1097909821 12:64957921-64957943 CCCTGGCCCTCAATGTGGAAGGG - Intergenic
1098383936 12:69898508-69898530 CCCTGGCCCCTGCAGAGGGATGG - Intronic
1102284439 12:111644243-111644265 CACTGCCCCCCGAAGAGGCAGGG + Exonic
1102481949 12:113229861-113229883 CCCCAACCCCCATAGAGGGATGG - Intronic
1102581884 12:113894435-113894457 CCCTGGCACCCTCTGAGGGAGGG + Intronic
1102867049 12:116382817-116382839 ACCTGCCCCCCATATAGGGAAGG + Intergenic
1103408534 12:120693723-120693745 GCCTGGTTCCCCAAGAGGGAGGG - Intronic
1104195269 12:126531138-126531160 CCCTGACTCCCAAAGAGAGAAGG - Intergenic
1104815039 12:131640696-131640718 TGCTGGCACCCAGAGAGGGAAGG - Intergenic
1106125631 13:26898094-26898116 CCATGGACCCCAATGAGGAAGGG - Intergenic
1108118707 13:47160209-47160231 CCCTGGCCCCCAAGAATGCAGGG - Intergenic
1109290942 13:60474197-60474219 CCTTGGCTGCCAAACAGGGAAGG + Intronic
1110003197 13:70232507-70232529 CCCTGGCCCCCAACACAGGATGG + Intergenic
1110421448 13:75313968-75313990 CCCTGTCCCCCAAAAATTGAGGG - Intronic
1111634418 13:90885098-90885120 TACTGGCCCCAAAAGAGGAATGG + Intergenic
1112491007 13:99863825-99863847 CCCCAGCCCCCACAGAGGGCAGG + Intronic
1115661894 14:35503854-35503876 CCCTGGAGACTAAAGAGGGAGGG - Intergenic
1117099939 14:52335569-52335591 CACTGGAACCCAAACAGGGAGGG + Intergenic
1118096698 14:62545528-62545550 CCCTGGCCCCCAAAGGGGGATGG - Intergenic
1118464941 14:66022501-66022523 CCTGGGCCCCCAAGGAGGCAAGG + Intergenic
1120073324 14:80127277-80127299 CCCTGGCCAGCAAAGATGGAAGG + Intergenic
1121961514 14:98264479-98264501 CCCTGGAAGCCAAAGAGGTAAGG + Intergenic
1122325142 14:100877371-100877393 TCCTGGCCATCAAAGATGGAGGG - Intergenic
1122982174 14:105196823-105196845 CCCAGGCCGCGAAGGAGGGAAGG - Intergenic
1124383171 15:29184792-29184814 CCATGGTCCCCAAAGTGAGAGGG - Intronic
1124891013 15:33732866-33732888 AGCTGGCCCCTAAAGGGGGAAGG - Intronic
1125882911 15:43209205-43209227 CCCTGGCCTCCCATGTGGGAAGG - Intronic
1127313286 15:57771035-57771057 TCCTGGCCTCCAAAGTGTGAGGG + Intronic
1131170478 15:90174659-90174681 CCATGGCCACAAAAGGGGGAGGG + Intronic
1131571741 15:93544350-93544372 CCTTGGCGCTCACAGAGGGAAGG + Intergenic
1131985819 15:98042121-98042143 CCCTGAACCCCCAGGAGGGATGG - Intergenic
1132178043 15:99731509-99731531 CCCTGGCCCCCAAAGAGGGAGGG - Intronic
1132702959 16:1229791-1229813 GGCTGGCCCCCACACAGGGAAGG - Intronic
1132705364 16:1241077-1241099 GGCTGGCCCCCACACAGGGAAGG + Intronic
1132708495 16:1256440-1256462 GGCTGGCCCCCACACAGGGAAGG + Intronic
1132988961 16:2783357-2783379 CCCTGGCTCCCCAGGAGGAAAGG + Intergenic
1133595114 16:7283527-7283549 CCCTGGCCAACACAGAGGGGAGG - Intronic
1134513012 16:14863907-14863929 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134700650 16:16262396-16262418 CCCTGTTTCCCACAGAGGGAGGG - Intronic
1134971175 16:18532263-18532285 CCCTGTTTCCCACAGAGGGAGGG + Intronic
1135007308 16:18837686-18837708 CCCTGGCTACCAGATAGGGAAGG + Intronic
1136413680 16:30091302-30091324 TCCAGGGCCCCAAAGAGGGGAGG - Intronic
1136671204 16:31859958-31859980 CCTTGGCTACCAAATAGGGAAGG + Intergenic
1137716249 16:50600072-50600094 CCCTGGCCCCCACAGTGGTCAGG - Intronic
1137737051 16:50732418-50732440 CCCTGGCACCCAGGGTGGGAAGG + Exonic
1137756250 16:50904698-50904720 CTCTGGTCACCATAGAGGGAGGG + Intergenic
1137835236 16:51585846-51585868 CCTTGGCCCCCAAAGTAGCAAGG + Intergenic
1139137001 16:64216564-64216586 CCATGGACCTCAGAGAGGGAGGG + Intergenic
1140725710 16:77809701-77809723 CCATTGCCCACAAAGAGAGAGGG + Intronic
1141955706 16:87370161-87370183 CCCCGGGCCCCTGAGAGGGAGGG - Intronic
1142141481 16:88474566-88474588 CCCCGCCCCCCGAAGTGGGACGG - Intronic
1142273392 16:89102804-89102826 CCCTGGCCCCGACAGGGGAAAGG - Intronic
1142282665 16:89156707-89156729 CCCTGGCCCCTGATGAGGGAGGG - Intergenic
1143568481 17:7739790-7739812 CCCTGGGCACCAAAGAAGCAAGG - Exonic
1143842489 17:9744087-9744109 CCCTGGATCTCAAAGAGGAAGGG + Intergenic
1143963345 17:10738603-10738625 TCCTGGCCCACACAGAGGAAAGG + Intergenic
1144300991 17:13923019-13923041 CCCAGGCCCCCAACCTGGGAGGG - Intergenic
1144849803 17:18238324-18238346 CCCTGGGCCCTCCAGAGGGATGG + Intronic
1144991798 17:19238086-19238108 GCCTGGTCCCCAAGGACGGAAGG - Intronic
1145204715 17:20977025-20977047 CCCAGGCCCCCAGTGAAGGAGGG + Intergenic
1145750843 17:27353996-27354018 CCCGGGCCGGCGAAGAGGGAGGG + Intergenic
1146659707 17:34657554-34657576 CCCTGGGCCCCACAGATGGTAGG + Intergenic
1146931855 17:36783276-36783298 CCCTGGACCCGAGAGAGGCAAGG - Intergenic
1146993194 17:37294804-37294826 GACTGGACCCCAAAGGGGGACGG - Intronic
1147324271 17:39662916-39662938 CCCTGGCCCGCAGGGTGGGAGGG - Exonic
1147695653 17:42350630-42350652 GTCTGTCCCCCAAAGAGGGAGGG - Intronic
1148003962 17:44409788-44409810 CCCTGCCCCACACGGAGGGAAGG - Intronic
1148020441 17:44549719-44549741 CCCTCCACCCTAAAGAGGGAAGG - Intergenic
1148744517 17:49910862-49910884 CACTGGAGCCCAGAGAGGGAAGG - Intergenic
1151758291 17:76087129-76087151 TCCTTGCCCCCAAAATGGGACGG + Intronic
1152008163 17:77695267-77695289 CCCTGGGCCCCTCAGTGGGAGGG - Intergenic
1152241150 17:79161896-79161918 CCCTGGTCCCCACAGAGTGTGGG - Intronic
1152629382 17:81403240-81403262 CCCTGGCCCCTGGAGAGGGGAGG - Intronic
1154023491 18:10685525-10685547 CCCCGCCTCCCAATGAGGGAAGG - Intronic
1156413569 18:36861918-36861940 CCTTGGCCCCCAAAAAGTGCTGG + Intronic
1157222862 18:45839806-45839828 CCCTGTGCCCCAGAGAGGGAGGG + Intronic
1160503164 18:79412119-79412141 ACCTGGGACCCAAAGAAGGAAGG - Intronic
1160734664 19:657053-657075 CACTGGCCCCCACTGAGGGCAGG + Intronic
1160753725 19:747346-747368 CTTTAGCCCCCAAAGAGGCACGG - Exonic
1160820265 19:1054579-1054601 GCCAGGCCCACAAAGAGGGCAGG - Exonic
1160938769 19:1610287-1610309 CCTTGGACCACACAGAGGGAGGG + Exonic
1161801222 19:6417678-6417700 GCCTGCCTCCCAAAGAGGGTGGG + Intronic
1161824215 19:6551672-6551694 CCCTGGCCCCCCAAGAGCACAGG + Intergenic
1161940335 19:7398873-7398895 CCCTGGCCCACAAAGGGCAATGG - Intronic
1162523699 19:11195912-11195934 TTCTGGCCACCAAAGAGAGATGG + Intronic
1162577082 19:11505457-11505479 GCCTGGCCCCGAGGGAGGGAGGG - Intronic
1163075637 19:14888650-14888672 CCCTGACTGCCAAACAGGGAAGG - Intergenic
1163321135 19:16575708-16575730 CCCTCACCCCCAAAGAGGTGCGG - Exonic
1164596774 19:29535455-29535477 CCATGGCCCCCACAGAGAGCCGG + Intronic
1164858755 19:31545822-31545844 CACTGGCCCCAAAAGAGGGCTGG - Intergenic
1165213625 19:34254408-34254430 CCCTGGGCCCCCAAGCGGGACGG - Intergenic
1166704899 19:44903263-44903285 CCCCGACCCCCAAGGGGGGAGGG - Exonic
1166724655 19:45019311-45019333 CCCTGGCCTCCAAAAAGTGCTGG + Intronic
1166764636 19:45245470-45245492 CCCCTGGCCCCAGAGAGGGAGGG - Intronic
1167313911 19:48752981-48753003 CCCTGGCACCGGAAGAGAGAGGG - Exonic
1168103200 19:54152121-54152143 CCACGGCCCCCAAACAGGGCAGG + Intronic
1168487465 19:56776420-56776442 CCTTGAACCCTAAAGAGGGAAGG + Intronic
1168542619 19:57225709-57225731 CCCTGGCCCCCAAAGTGCTGGGG + Intergenic
927502665 2:23592793-23592815 TCCTGGCCCCCAAAGGGGAATGG + Intronic
928797090 2:35035060-35035082 TCCTGGGCCCCAAAGAGTGCAGG + Intergenic
929071863 2:38038936-38038958 GCCTGGCAGCCAAACAGGGAAGG + Intronic
930198391 2:48530390-48530412 CCCTGGGGCCCGCAGAGGGATGG + Intronic
931286259 2:60834555-60834577 CCCTGGCCCCCTGGGAGGGAGGG + Intergenic
931646260 2:64424669-64424691 CCTTGGCCCCCAGAGGGGCAGGG - Intergenic
933140473 2:78786946-78786968 CCCTTGCATCAAAAGAGGGATGG - Intergenic
937060587 2:118977832-118977854 CCCAGGACCCCAAGGAGAGAAGG + Exonic
937450030 2:121994260-121994282 CCCTGGGACCCTAAGATGGAAGG - Intergenic
938069534 2:128301095-128301117 CCCTGCCCCTCACAGAGGGAGGG - Intronic
938848735 2:135238612-135238634 CCCCGGCCCCCACAAAGCGATGG + Intronic
941005996 2:160247674-160247696 CCCCAGCCCCTAAAGAGTGAAGG + Intronic
941653064 2:168114384-168114406 CCCTGACGCACAATGAGGGAAGG + Intronic
942539368 2:176999519-176999541 TCCTGGGCCCCAAGGAGGGAAGG + Intergenic
942617506 2:177809354-177809376 AGCTGACCCCCACAGAGGGAGGG + Intronic
942949806 2:181709435-181709457 CCCAGGCCCCCAAAAATGGAGGG - Intergenic
943524487 2:188999362-188999384 CCCTGGTCCCGAAGGAGGAAAGG + Exonic
944483773 2:200182295-200182317 CCCTGGGCCCCCAAGAGTGCAGG - Intergenic
947956988 2:234200851-234200873 CCATGGCCCCCAAATAAGTAGGG - Intergenic
949032016 2:241801776-241801798 GCCTGGCCCCCAAACAGGCTGGG - Exonic
1168859737 20:1037324-1037346 CACTGGAACCCAAAGAGGAAAGG + Intergenic
1170932289 20:20779948-20779970 CCCTGCACCCCAAACTGGGAAGG + Intergenic
1172777530 20:37416171-37416193 CCAGAGCCCCCAGAGAGGGAAGG - Intergenic
1172807449 20:37622659-37622681 CCATGGCCCCCAAGAAGGGGTGG - Intergenic
1172881031 20:38200097-38200119 CCCTGGACTCCAGACAGGGAGGG + Intergenic
1173228280 20:41174781-41174803 TCCTGGCCCCACAAGATGGAAGG - Exonic
1174407317 20:50310664-50310686 CGCTGGGCCCCCAGGAGGGAGGG - Intergenic
1174868439 20:54161185-54161207 CCCTGGGGCAGAAAGAGGGATGG - Intronic
1176103991 20:63377104-63377126 CCCCACCCCCCAAGGAGGGATGG - Intronic
1180081852 21:45490766-45490788 CCCTGGCCCCCCGTGAGGGATGG - Intronic
1180112026 21:45663186-45663208 CCTTGGCTGCCAAACAGGGAAGG + Intronic
1181720236 22:24768635-24768657 CCCTGTCACCCATAGAGGTAAGG - Intronic
1181894201 22:26092727-26092749 TCCTGACCCCAACAGAGGGAGGG + Intergenic
1183484439 22:38081724-38081746 CCCTGGCCCCCACAGGAGGGAGG + Intronic
1183667098 22:39252445-39252467 CCCTGGTGCCCCAAGGGGGAAGG - Intergenic
1184257219 22:43294200-43294222 CCCCGGCCCCCGAGGAGGGGAGG + Intronic
1184460387 22:44634504-44634526 CCCTGGCCCATGGAGAGGGAAGG + Intergenic
1184514597 22:44954295-44954317 GCTGGGTCCCCAAAGAGGGAGGG - Intronic
1184694803 22:46133344-46133366 GCCTGGCCCCCAGGGAGGGATGG + Intergenic
1184941052 22:47765585-47765607 ACCTGACCACCAAGGAGGGAGGG + Intergenic
1185013092 22:48327153-48327175 CCTCGGCCCCCAAATAGGTAAGG - Intergenic
1185289821 22:50017669-50017691 CCCTGGCCTCCATACAGGGTTGG - Intronic
1185350463 22:50333944-50333966 CCTTGGCTACCAAATAGGGAAGG - Intergenic
949879109 3:8647983-8648005 CCCTGGCTCCCAGAGAGAGGAGG - Intronic
950116017 3:10450718-10450740 TCCTGGGCTCCAGAGAGGGACGG - Intronic
950634395 3:14304603-14304625 CCAGGGACACCAAAGAGGGATGG - Intergenic
953916437 3:46923737-46923759 CCGTGGCCCCCAGGGAGAGACGG + Intronic
953981933 3:47417662-47417684 GGCTGGTCCCCGAAGAGGGAAGG + Exonic
954130316 3:48557235-48557257 CCCAGGGCCCCCAGGAGGGAGGG + Intronic
954135994 3:48582477-48582499 CACTGGCCGCCAAGGAGAGAAGG - Exonic
954424034 3:50434023-50434045 CCCAGGCCCGGAAGGAGGGAGGG + Intronic
955374639 3:58384942-58384964 CTAAGGCCCCCAGAGAGGGAGGG + Intronic
959078840 3:101779285-101779307 CCCTGGCCCCCGGAGAGCGAAGG + Intronic
959760946 3:109964272-109964294 CTCAGGACTCCAAAGAGGGAGGG + Intergenic
960671935 3:120162782-120162804 CCTCGGCCTCCCAAGAGGGAGGG - Intergenic
960997904 3:123351738-123351760 ACTCCGCCCCCAAAGAGGGAAGG + Intronic
961081345 3:124031892-124031914 CCTTGGCCCCCAGAGAGAGGTGG + Intergenic
962392484 3:134984578-134984600 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
962392496 3:134984607-134984629 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
962392508 3:134984636-134984658 ACCTGGGCCCCAGAGAGGGAAGG + Intronic
962815250 3:138991974-138991996 CCCTGGACTACAAAGAGGCAGGG - Intergenic
963299590 3:143583878-143583900 CCCTGCCACCCAAAGATGGTAGG - Intronic
964443117 3:156732412-156732434 CACTGGCATTCAAAGAGGGATGG + Intergenic
967129374 3:186456518-186456540 CCCAGGCCCCCAGAGGAGGAAGG + Intergenic
967131160 3:186471880-186471902 CCAAAGCCCCCAAAGAGGGCAGG + Intergenic
967444930 3:189555256-189555278 CCTAGGCCCCCAAAGAGTGCAGG + Intergenic
967965996 3:194960737-194960759 CTCTGGCTCCCAGAGAGGGGCGG + Intergenic
968238748 3:197055659-197055681 GTCTGGCCCCCAAAAGGGGAGGG + Intronic
968288223 3:197520443-197520465 CCCCGGCCCACACAGAGGGGAGG - Intronic
968644002 4:1729529-1729551 CCTTGGCTGCCAAACAGGGAAGG - Intronic
968746220 4:2361970-2361992 CCATGGGCCCCAACAAGGGACGG + Intronic
968969522 4:3786313-3786335 CCCAGGGCCACAAAGAGGGCTGG + Intergenic
969078771 4:4601968-4601990 CCCTGGCCCCGACAGAAGGTCGG + Intergenic
969085476 4:4653039-4653061 CCCTGGCCCCCTGAGGGGGGTGG + Intergenic
969495496 4:7523887-7523909 CCCAGGGGCCCAAGGAGGGAGGG - Intronic
969511317 4:7619612-7619634 CACTGGCACCCAAGGAGGCAGGG - Intronic
972397869 4:38672846-38672868 GCCTGGCCCCCAAGGCAGGAGGG + Intronic
977557416 4:98499304-98499326 CCTTGGCCCCTGAGGAGGGAAGG - Intronic
985554232 5:548440-548462 CCGTGGGCCCCAAAGAGAGAGGG + Intergenic
985991517 5:3565705-3565727 CACTGGCCCCCAACGAGGCCAGG + Intergenic
986345003 5:6826778-6826800 CCAGGGCCTCCAAAGATGGATGG - Intergenic
987212303 5:15695286-15695308 CCCTGGACACCAAGGATGGAAGG + Intronic
987500116 5:18698369-18698391 CCTTGGCTGCCAAACAGGGAAGG - Intergenic
991592908 5:68273091-68273113 CCCTGGGCCCCAAAGGTGGGGGG - Intronic
993379510 5:87190381-87190403 TCCTGGCTTCCAGAGAGGGAAGG - Intergenic
994670228 5:102755049-102755071 CCCCTGCGCCCAAAGAGGCAGGG + Intronic
997429813 5:133829959-133829981 CCCTAGCCCCCACTGAGGGATGG + Intergenic
997574422 5:134963121-134963143 CTCTGGCCCCTAAAGAGAGGTGG - Intronic
997661209 5:135590713-135590735 CCCTGTCCTGCAAAGAGGGTGGG + Intergenic
1002173035 5:177385939-177385961 CCCAGGGCCCCAAAGTGGGGAGG - Intronic
1004672986 6:17815109-17815131 CCTTGGCTGCCAAACAGGGAAGG - Intronic
1006300807 6:33192749-33192771 CTCTGGGCCCCCAAGAGGGAGGG - Intergenic
1007249473 6:40486035-40486057 CCCTCGCCCCGCAGGAGGGAGGG - Intronic
1007702476 6:43772976-43772998 TCCTGGGCCCCAAGGAGGAAAGG - Intronic
1008536550 6:52510396-52510418 CCCTGGGACCCAAAGGGAGAGGG + Intronic
1011064229 6:83307744-83307766 CCCTGGCTTCCCAACAGGGAAGG - Intronic
1011808043 6:91095534-91095556 CTCTGGCCCCCAGAGAGGCATGG - Intergenic
1012374814 6:98548570-98548592 CCCTGGCCTCCAACCAGAGATGG - Intergenic
1013972683 6:116039775-116039797 CCCTAGGCCCTAATGAGGGAAGG + Intronic
1017146383 6:151239676-151239698 CACAGGCCCTCAAAGAAGGACGG + Intergenic
1017265927 6:152446243-152446265 TCCTGTCACCAAAAGAGGGAAGG + Intronic
1018587489 6:165377899-165377921 TCCTGGACCACAAAGAGGGATGG - Intronic
1018747841 6:166776099-166776121 ACCTGGCCCCCAGAGCCGGATGG - Intronic
1018956810 6:168415823-168415845 GCCTGGCGCCCCAAGAGAGACGG + Intergenic
1019344587 7:522979-523001 CCCTGGCACCCAGGGAGGGCGGG + Intergenic
1019603005 7:1894691-1894713 CCCAGCCCTCCAAAGAGGGGAGG + Intronic
1021621567 7:22555014-22555036 CCCTGGAGCCCAAGGAGGGTGGG - Intronic
1022464511 7:30644327-30644349 CTTTGGCTCCCAAAGAGAGAAGG - Intergenic
1023761638 7:43469812-43469834 CCTTGGACCATAAAGAGGGAGGG - Intronic
1024855934 7:53779182-53779204 CCCTGGCACACAAAGAGGAGAGG + Intergenic
1026446209 7:70487059-70487081 CCTTGCCTCCCAAATAGGGAGGG - Intronic
1026904671 7:74056257-74056279 GCCTGGCCCCTGCAGAGGGAAGG - Exonic
1027139480 7:75647004-75647026 CCAGGGCCTCCTAAGAGGGAGGG + Intronic
1028431119 7:90748315-90748337 CCCTGACCCCCAGAGAGCAATGG - Intronic
1031869444 7:127076209-127076231 CCCTGAATCCCAAACAGGGATGG + Intronic
1032506296 7:132437055-132437077 CCTTGGCCCCAAAACACGGATGG + Intronic
1033885769 7:145943115-145943137 CCCTGCCCCCCAAAGCCAGAAGG + Intergenic
1034803121 7:154065294-154065316 CCAGGGCCCTCAAAGAGTGATGG - Intronic
1034803132 7:154065336-154065358 CCAGGGCCCTCAAAGAGTGATGG - Intronic
1035079507 7:156204259-156204281 ACCTGTCCCCCAAGGAGGGAGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035414427 7:158671066-158671088 CCCTGCCCCACACAGAGTGAAGG - Intronic
1035414450 7:158671148-158671170 CCCTGCCCCACACAGAGTGAAGG - Intronic
1035550378 8:519058-519080 CTCTGACCTCCAAAGAGAGAAGG + Intronic
1038002391 8:23403287-23403309 CCCTGGTCCCCGGAGAGGCAGGG + Intronic
1039751252 8:40481060-40481082 CCATGACCCCCAAAGAGCCAGGG - Intergenic
1043008001 8:74844669-74844691 CCATCTCCCCCAAATAGGGAAGG + Intronic
1044053204 8:87535642-87535664 TCCTGGACCCAAAAGAGGGTAGG - Intronic
1045309805 8:100991367-100991389 CCCTTTCCCCCCAAGATGGATGG + Intergenic
1045939260 8:107718794-107718816 CCCTGGAGCTCAAAGAAGGATGG + Intergenic
1047878459 8:129166703-129166725 AGCTGCTCCCCAAAGAGGGATGG - Intergenic
1048630487 8:136237297-136237319 CCCTGATCCCCAAAGAATGACGG - Intergenic
1048997218 8:139801467-139801489 ACCTGGCCCCCAAGGAGGCATGG + Intronic
1049660738 8:143818704-143818726 CCCCGCCACCCAAAGAAGGAAGG + Intronic
1049683703 8:143930864-143930886 GCCTGGCCCCCGCAGAGGGGTGG - Intronic
1052866775 9:33468865-33468887 CCCTGGCCCTGAAAGAGACAGGG + Exonic
1053510400 9:38682990-38683012 GCCTGGCCCCCAAGGAGGGGAGG + Intergenic
1056691514 9:88812228-88812250 CCCTGTCCCTCAAAAGGGGAAGG - Intergenic
1057208057 9:93184915-93184937 CCTTGGCCCACAGAGATGGACGG + Exonic
1059411005 9:114132386-114132408 CCCTGGCCCCCACGCAGTGATGG + Intergenic
1059763498 9:117361661-117361683 CCCTGGACCCTAAAAAGGCAAGG + Intronic
1060330877 9:122669168-122669190 CCTTGGCCCCCCAAGAGTGCTGG + Intergenic
1060516700 9:124270400-124270422 CCCAGGTCCCCAGAGTGGGAGGG + Intronic
1061295631 9:129675388-129675410 CCCTGGCCACCAAAGCTAGAGGG - Intronic
1061488858 9:130934247-130934269 CCCTGGCCCTGGCAGAGGGAGGG + Intronic
1061785555 9:133025868-133025890 CCTTGGCTGCCAAATAGGGAAGG + Intergenic
1062011987 9:134272342-134272364 CTCTGGCCCTAAAGGAGGGATGG + Intergenic
1062077544 9:134599015-134599037 CCCTGTCCCCATGAGAGGGAGGG + Intergenic
1062081582 9:134626802-134626824 CCCTGGGCCCCCAGGAGGGCAGG + Intergenic
1062484290 9:136767003-136767025 CCTTGGCTGCCAAACAGGGAAGG + Intergenic
1190713898 X:53088279-53088301 CCCTGACCCCCGAAGCGGGGAGG + Exonic
1191105400 X:56769139-56769161 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191106393 X:56774541-56774563 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1191107386 X:56779943-56779965 GCCTGGGCTCCAGAGAGGGAGGG - Intergenic
1192183222 X:68929348-68929370 CCCTCGACCCCACAGGGGGAGGG - Intergenic
1193207143 X:78762514-78762536 CCCAGGCCCTCAGAGAGGGAAGG - Intergenic
1195259143 X:103115789-103115811 TCCTGTCTCTCAAAGAGGGATGG + Intergenic
1198718217 X:139585433-139585455 CTGTGGCCCCCAAAGAAGTAAGG - Intronic
1199614682 X:149647420-149647442 TCCTGGGCCCCCAAGAGGGCAGG - Intergenic
1200058704 X:153474602-153474624 CCCGGGCCCCAAAAATGGGAGGG + Intronic
1200239027 X:154484233-154484255 CCCTGGCCCCCCACGAGAGCTGG - Exonic
1200247678 X:154534675-154534697 CCCTGGCACCCAGGGTGGGAAGG - Intronic