ID: 1132179017

View in Genome Browser
Species Human (GRCh38)
Location 15:99737623-99737645
Sequence CTTTATTCCAGGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132179017_1132179022 19 Left 1132179017 15:99737623-99737645 CCTCTCTGCTGCCTGGAATAAAG No data
Right 1132179022 15:99737665-99737687 TGCAGTCATCTTGGACCATGAGG No data
1132179017_1132179023 22 Left 1132179017 15:99737623-99737645 CCTCTCTGCTGCCTGGAATAAAG No data
Right 1132179023 15:99737668-99737690 AGTCATCTTGGACCATGAGGTGG No data
1132179017_1132179021 10 Left 1132179017 15:99737623-99737645 CCTCTCTGCTGCCTGGAATAAAG No data
Right 1132179021 15:99737656-99737678 CAGAGCACATGCAGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132179017 Original CRISPR CTTTATTCCAGGCAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr