ID: 1132179220

View in Genome Browser
Species Human (GRCh38)
Location 15:99739191-99739213
Sequence TTGGATACTGACGGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132179220_1132179227 11 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179227 15:99739225-99739247 CCAATCAAGCAATATTGTCAGGG No data
1132179220_1132179231 17 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179231 15:99739231-99739253 AAGCAATATTGTCAGGGGAGGGG No data
1132179220_1132179228 12 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179228 15:99739226-99739248 CAATCAAGCAATATTGTCAGGGG No data
1132179220_1132179225 10 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179225 15:99739224-99739246 ACCAATCAAGCAATATTGTCAGG No data
1132179220_1132179229 15 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179229 15:99739229-99739251 TCAAGCAATATTGTCAGGGGAGG No data
1132179220_1132179230 16 Left 1132179220 15:99739191-99739213 CCCAGATGGCCGTCAGTATCCAA No data
Right 1132179230 15:99739230-99739252 CAAGCAATATTGTCAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132179220 Original CRISPR TTGGATACTGACGGCCATCT GGG (reversed) Intergenic
No off target data available for this crispr