ID: 1132180527

View in Genome Browser
Species Human (GRCh38)
Location 15:99749465-99749487
Sequence AGTCATGGCCGTGTGCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132180527_1132180535 23 Left 1132180527 15:99749465-99749487 CCCACGGGCACACGGCCATGACT No data
Right 1132180535 15:99749511-99749533 CATTTGGGTGGTTCACTTCCAGG No data
1132180527_1132180532 7 Left 1132180527 15:99749465-99749487 CCCACGGGCACACGGCCATGACT No data
Right 1132180532 15:99749495-99749517 CAGAGGACAGTGCTTTCATTTGG No data
1132180527_1132180534 11 Left 1132180527 15:99749465-99749487 CCCACGGGCACACGGCCATGACT No data
Right 1132180534 15:99749499-99749521 GGACAGTGCTTTCATTTGGGTGG No data
1132180527_1132180530 -10 Left 1132180527 15:99749465-99749487 CCCACGGGCACACGGCCATGACT No data
Right 1132180530 15:99749478-99749500 GGCCATGACTGTCTGGACAGAGG No data
1132180527_1132180533 8 Left 1132180527 15:99749465-99749487 CCCACGGGCACACGGCCATGACT No data
Right 1132180533 15:99749496-99749518 AGAGGACAGTGCTTTCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132180527 Original CRISPR AGTCATGGCCGTGTGCCCGT GGG (reversed) Intergenic
No off target data available for this crispr