ID: 1132180579

View in Genome Browser
Species Human (GRCh38)
Location 15:99749934-99749956
Sequence GTATGGCATCTTGACAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132180573_1132180579 8 Left 1132180573 15:99749903-99749925 CCTGACTCAGAGCATGATACCCC No data
Right 1132180579 15:99749934-99749956 GTATGGCATCTTGACAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132180579 Original CRISPR GTATGGCATCTTGACAAGCT AGG Intergenic
No off target data available for this crispr