ID: 1132183013

View in Genome Browser
Species Human (GRCh38)
Location 15:99776471-99776493
Sequence CGCTACTCGGGAGGCCGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132183013_1132183022 6 Left 1132183013 15:99776471-99776493 CCGCCTCGGCCTCCCGAGTAGCG No data
Right 1132183022 15:99776500-99776522 ACAGGCGTCCCCACCACGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132183013 Original CRISPR CGCTACTCGGGAGGCCGAGG CGG (reversed) Intergenic
No off target data available for this crispr