ID: 1132184577

View in Genome Browser
Species Human (GRCh38)
Location 15:99792198-99792220
Sequence TGGCCTTATGGACCTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132184572_1132184577 -3 Left 1132184572 15:99792178-99792200 CCATTATTTTGGCTCCAGAGTGG No data
Right 1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG No data
1132184568_1132184577 10 Left 1132184568 15:99792165-99792187 CCGAGATGTGACCCCATTATTTT No data
Right 1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG No data
1132184571_1132184577 -2 Left 1132184571 15:99792177-99792199 CCCATTATTTTGGCTCCAGAGTG No data
Right 1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG No data
1132184570_1132184577 -1 Left 1132184570 15:99792176-99792198 CCCCATTATTTTGGCTCCAGAGT 0: 1
1: 15
2: 16
3: 26
4: 216
Right 1132184577 15:99792198-99792220 TGGCCTTATGGACCTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132184577 Original CRISPR TGGCCTTATGGACCTCCTGG AGG Intergenic
No off target data available for this crispr