ID: 1132194858

View in Genome Browser
Species Human (GRCh38)
Location 15:99906663-99906685
Sequence GTTGTAATGGAACAAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132194856_1132194858 22 Left 1132194856 15:99906618-99906640 CCTCAGGAGGTTTTAAGCTTCAT No data
Right 1132194858 15:99906663-99906685 GTTGTAATGGAACAAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132194858 Original CRISPR GTTGTAATGGAACAAAAATC AGG Intergenic
No off target data available for this crispr