ID: 1132199977

View in Genome Browser
Species Human (GRCh38)
Location 15:99944628-99944650
Sequence ATCCCAACTGGGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132199971_1132199977 -8 Left 1132199971 15:99944613-99944635 CCTAGTTTTTAGTTGATCCCAAC No data
Right 1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG No data
1132199969_1132199977 -4 Left 1132199969 15:99944609-99944631 CCCTCCTAGTTTTTAGTTGATCC No data
Right 1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG No data
1132199970_1132199977 -5 Left 1132199970 15:99944610-99944632 CCTCCTAGTTTTTAGTTGATCCC No data
Right 1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG No data
1132199968_1132199977 18 Left 1132199968 15:99944587-99944609 CCTTTTCTCTGTAGGAAATAGTC No data
Right 1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132199977 Original CRISPR ATCCCAACTGGGAAATGGGG TGG Intergenic
No off target data available for this crispr