ID: 1132200973

View in Genome Browser
Species Human (GRCh38)
Location 15:99954507-99954529
Sequence TGGCCCCTGGCTGAAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132200964_1132200973 18 Left 1132200964 15:99954466-99954488 CCCGCAGATAGGAGCTGAGTCAT No data
Right 1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG No data
1132200961_1132200973 29 Left 1132200961 15:99954455-99954477 CCTGGGCCTAACCCGCAGATAGG No data
Right 1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG No data
1132200963_1132200973 23 Left 1132200963 15:99954461-99954483 CCTAACCCGCAGATAGGAGCTGA No data
Right 1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG No data
1132200965_1132200973 17 Left 1132200965 15:99954467-99954489 CCGCAGATAGGAGCTGAGTCATG No data
Right 1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132200973 Original CRISPR TGGCCCCTGGCTGAAGCAAG GGG Intergenic
No off target data available for this crispr