ID: 1132204316

View in Genome Browser
Species Human (GRCh38)
Location 15:99976078-99976100
Sequence TCCTGTCGTTGCAGACCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132204314_1132204316 11 Left 1132204314 15:99976044-99976066 CCAAGGCGGGGGGAGGTGATGGT 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1132204316 15:99976078-99976100 TCCTGTCGTTGCAGACCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1132204306_1132204316 27 Left 1132204306 15:99976028-99976050 CCAGTGAAGACACTCACCAAGGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1132204316 15:99976078-99976100 TCCTGTCGTTGCAGACCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132204316 Original CRISPR TCCTGTCGTTGCAGACCTCC TGG Exonic