ID: 1132204771

View in Genome Browser
Species Human (GRCh38)
Location 15:99978697-99978719
Sequence GACTCCCGCCCTGCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132204767_1132204771 13 Left 1132204767 15:99978661-99978683 CCCGCCTTGAACACAAGACAGGT 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1132204771 15:99978697-99978719 GACTCCCGCCCTGCTGGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
1132204769_1132204771 9 Left 1132204769 15:99978665-99978687 CCTTGAACACAAGACAGGTGCTA 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1132204771 15:99978697-99978719 GACTCCCGCCCTGCTGGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
1132204768_1132204771 12 Left 1132204768 15:99978662-99978684 CCGCCTTGAACACAAGACAGGTG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1132204771 15:99978697-99978719 GACTCCCGCCCTGCTGGTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132204771 Original CRISPR GACTCCCGCCCTGCTGGTGT TGG Intronic
900353717 1:2249618-2249640 GACTCCCCACCTGCTGCTGTTGG + Intronic
906060088 1:42942783-42942805 CACTCCCAGCCTGCAGGTGTGGG - Intronic
906449124 1:45929372-45929394 AACTCCCCCCCTGCTGCTCTGGG - Intronic
911651929 1:100398802-100398824 GACTCCCTGCCTGTTGGTGTGGG + Intronic
912381831 1:109251700-109251722 GAATACCGCCTTGCTGGGGTGGG + Exonic
917906619 1:179591903-179591925 GACGCCAGCGCTGCTGGTGCGGG - Exonic
918088131 1:181262777-181262799 GACTCCTTCCCTGCTTGTGGAGG - Intergenic
919780611 1:201218486-201218508 GAGTCCCACCCTGATGGTGCTGG - Intronic
921065628 1:211620524-211620546 GGGTGCCTCCCTGCTGGTGTGGG - Intergenic
922246034 1:223798493-223798515 GGCTGCTGCCCTGCTGGTTTTGG + Exonic
922616626 1:226964800-226964822 GGCTCCAGCCCTGCTTCTGTTGG - Intronic
923497013 1:234534565-234534587 GACTCCCGCCCTTCAGGGGAGGG + Intergenic
923537940 1:234867445-234867467 GGCTCCTGTCTTGCTGGTGTAGG - Intergenic
924812519 1:247415948-247415970 GCCTCCCACCCTGCTTCTGTGGG + Intergenic
1064140017 10:12782627-12782649 GATGCCCCCCCTGCTGGTGGGGG - Intronic
1067061753 10:43081375-43081397 GGCTCCTGCCCTGCTGCTCTAGG + Intronic
1067809889 10:49418202-49418224 GGCTCCCGCCCTGGGGGTGGGGG + Intergenic
1069158212 10:65054482-65054504 AACTTCAGCCCTGCGGGTGTTGG - Intergenic
1071382963 10:85088021-85088043 GACTCCCACCATGCAGATGTTGG - Intergenic
1077919131 11:6630257-6630279 CACTCCCGCGCTGCTGCTGCTGG - Exonic
1083816252 11:65134096-65134118 GACGCCCGCCCTGCGGGAGCGGG + Intronic
1085726170 11:78956443-78956465 GCCACCCAGCCTGCTGGTGTTGG + Intronic
1089015814 11:115164374-115164396 GACTCCCTGCTTGCTGGAGTGGG - Intergenic
1090249683 11:125242547-125242569 GACTGCTGCCCAGCTGGTGGGGG + Intronic
1090264879 11:125347521-125347543 GACTGCCGACCTGGTGGTGCAGG + Intronic
1090473517 11:127000428-127000450 GACCCCTGCGCTGCTGGAGTTGG - Intronic
1101085409 12:101230613-101230635 GGCTCCTGCCCTTCTGGTTTGGG + Intergenic
1104699330 12:130889837-130889859 GTCTCACGCACTGCTGGTGGCGG - Intergenic
1108080092 13:46726562-46726584 GACTCAGCCCTTGCTGGTGTGGG - Intronic
1115196014 14:30800135-30800157 GACTAGTGCCCTGATGGTGTTGG + Intergenic
1117920898 14:60724191-60724213 CACTCCCTCCCTCCTGGTTTCGG + Intronic
1118431528 14:65723528-65723550 GATTCCAGCCCTTCTGTTGTGGG - Intronic
1119380372 14:74224474-74224496 TATTCCGGCCCTCCTGGTGTGGG - Intergenic
1119727994 14:76933655-76933677 GACTCCCGAGTTTCTGGTGTGGG - Intergenic
1121347110 14:93144316-93144338 GACGCCCACCCTGGGGGTGTTGG + Intergenic
1121537250 14:94699359-94699381 GACTCCCGCCCTCCTGTATTTGG + Intergenic
1121831771 14:97058678-97058700 GACTCCAGCCCTGCAGATTTTGG - Intergenic
1122649297 14:103216844-103216866 GGCTCCAGGCCTGCTGCTGTCGG - Intergenic
1123024658 14:105419171-105419193 GACTCCAGCCCTGTTGGGGCTGG + Intronic
1125577215 15:40764108-40764130 GACTCCAGCCCTTCTCGCGTCGG - Exonic
1132166056 15:99591953-99591975 GATTTCCCCCCTGGTGGTGTGGG + Intronic
1132204771 15:99978697-99978719 GACTCCCGCCCTGCTGGTGTTGG + Intronic
1132602878 16:781775-781797 GACCCCCGTCCTGCTGCTGCTGG + Intronic
1133222205 16:4323600-4323622 GTCACCCTCCCTGCTGGCGTTGG + Intronic
1135299093 16:21310293-21310315 GACTCCTGCCCTGCTCATCTCGG + Intergenic
1139964480 16:70737912-70737934 GCCTCCCTCCCTGCTGGGGTTGG + Intronic
1142015908 16:87747196-87747218 AAGTCCCGCCAGGCTGGTGTTGG - Intronic
1144556502 17:16287075-16287097 GAGCCCCGCTCTGGTGGTGTGGG + Intronic
1146529734 17:33598351-33598373 GAAACCAGCCCTGCTGGTGGAGG - Intronic
1146674556 17:34764394-34764416 CCCTCCAGCCCTGCTGGTTTTGG + Intergenic
1148245195 17:46025710-46025732 GACACCCAGCCTGCTGCTGTGGG - Exonic
1151468700 17:74304432-74304454 GGCTCAGGCCCTGCTGGTGGAGG + Intronic
1151682739 17:75630347-75630369 GACTCCAGGCCTGGTGGGGTAGG + Intronic
1152572714 17:81127597-81127619 GACGCCCTACCTGCTGGTGATGG - Exonic
1154199165 18:12287528-12287550 GACGCCCGCCCTGCCTGTGCCGG - Intergenic
1157700703 18:49760125-49760147 TTCTCCCGCCCTGCGGGTTTCGG + Intergenic
1161231902 19:3178729-3178751 GCCACCCGCCTTGCTGGTCTTGG - Intronic
1161398932 19:4059153-4059175 GTCTCCCCCCATGCTGGGGTGGG - Intronic
1161626632 19:5330763-5330785 GACTCCGGCCCTGCTGGGGAAGG - Intronic
1163371271 19:16902621-16902643 GCCACCTGCCCTGCTGGCGTGGG - Intronic
1164090386 19:21946457-21946479 GCCTCCCTCTCTGCTGGAGTAGG + Intronic
1164194512 19:22944266-22944288 GCCTCCCTCTCTGCTGGAGTAGG + Intergenic
1165534483 19:36431839-36431861 CACTCCCCTCCTGTTGGTGTAGG - Intergenic
928336936 2:30406275-30406297 GACTCACACCCTGCAGGTGCCGG - Intergenic
931189344 2:59984676-59984698 GACTCCAGCCCAACTGGTCTGGG - Intergenic
935133413 2:100278349-100278371 GGCTCCAGCCCTGATGGGGTGGG - Exonic
936236300 2:110745407-110745429 GACCCCCCACCTTCTGGTGTGGG - Intronic
945585246 2:211653486-211653508 CACGCCCGCCCCGCTGGTTTGGG + Intronic
948920947 2:241065658-241065680 GACAGCCGCCCTGCAGGTGCCGG - Intronic
1174375063 20:50121052-50121074 GCCTCCCTCCCAGCTGCTGTGGG - Intronic
1179906631 21:44426256-44426278 GACCCCCGCCCTCCTGGTGCAGG + Intronic
1182796531 22:32995111-32995133 CCCTCCCTCCCTGCTGGTGGCGG + Intronic
1184570317 22:45319449-45319471 CACTCCCGGCCTCCTGCTGTGGG - Intronic
951045927 3:18038276-18038298 GACACCCACCCTACTGTTGTAGG + Intronic
961447177 3:126986309-126986331 GACTCCTCCCCTGCTGTTCTTGG + Intergenic
961461693 3:127054176-127054198 GACTTGCTCACTGCTGGTGTTGG + Intergenic
961652562 3:128424198-128424220 GGCACCCAGCCTGCTGGTGTAGG - Intergenic
962678521 3:137774734-137774756 GACTCCCTCTCTGCTGCTGTGGG + Intergenic
967080494 3:186045183-186045205 CACTGCCGCCCTTCTAGTGTTGG - Intergenic
968629275 4:1641834-1641856 AGCCCCCGCCCAGCTGGTGTGGG + Intronic
970547538 4:17145126-17145148 CATTCACTCCCTGCTGGTGTAGG + Intergenic
973032627 4:45362555-45362577 GACTTCCCCCTTGCTGTTGTTGG + Intergenic
978196331 4:105976444-105976466 GGCTCCAGCAGTGCTGGTGTTGG - Intronic
990294336 5:54385022-54385044 GACTGCAGCCTTGCTGGTGAGGG - Intergenic
992519862 5:77539491-77539513 GATTCCAGTCCTGCTGGTCTAGG + Intronic
997215030 5:132103148-132103170 GAGTCCTGTCCTCCTGGTGTCGG - Intergenic
999432522 5:151536512-151536534 GATTCCTGCCCTGCTGCTGCAGG - Intronic
1001911827 5:175526333-175526355 CTCTCAGGCCCTGCTGGTGTTGG - Intronic
1002047971 5:176552730-176552752 GCCTCCTGCTCTGCTGGGGTTGG - Intronic
1004914361 6:20318696-20318718 AACTCCCGCTCAGCAGGTGTCGG - Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1018363530 6:163096328-163096350 GCCTCCTGCCCAGCTGGTTTGGG - Intronic
1019727183 7:2609486-2609508 GACTCCTGGACTGCTGCTGTGGG + Intronic
1020089966 7:5333378-5333400 GGCTGCTGCCCTGCAGGTGTGGG - Intronic
1026731847 7:72918682-72918704 GAAGTCAGCCCTGCTGGTGTGGG - Intronic
1031887219 7:127254482-127254504 CACTTCCTCCCTGGTGGTGTTGG + Intergenic
1036035618 8:5015367-5015389 AACTCTCATCCTGCTGGTGTCGG - Intergenic
1042493785 8:69433494-69433516 GATTCCCACCCTGCTGGGATGGG - Intergenic
1045835604 8:106517570-106517592 GAATTCTGCCCTGCTGGTGGTGG - Intronic
1049285179 8:141770895-141770917 GACTCCCGCCGTGCAGGATTGGG + Intergenic
1049394665 8:142394303-142394325 TCCACCCGCCCTGCTGCTGTGGG - Intronic
1050339316 9:4620128-4620150 GACTCCTGCCCAGCTGGGGGTGG - Intronic
1057379430 9:94554751-94554773 CACTCCCTCCCTGTTGGTGGTGG - Intergenic
1057499506 9:95585518-95585540 GACACTCGCCCTTCTGGTCTTGG + Intergenic
1061015747 9:127980238-127980260 GGATCCCGCCCTGATGGTGGCGG + Exonic
1061120776 9:128641023-128641045 GACCCCCTCCTTGCTGCTGTGGG + Intronic
1062149437 9:135009959-135009981 GCCTCCTGCCCTGAAGGTGTGGG + Intergenic
1187177884 X:16913300-16913322 GCCTCATGCCCTGCTGGTTTGGG + Intergenic
1189993023 X:46612386-46612408 GACTCCTGCACTCCTGGTGTGGG - Intronic
1197858991 X:130949718-130949740 GACTCCAGCCCTTCTGGTAAGGG - Intergenic
1198031916 X:132761419-132761441 GGCTCGCCCCCTGCTGGGGTGGG - Intronic