ID: 1132204882

View in Genome Browser
Species Human (GRCh38)
Location 15:99979477-99979499
Sequence AAAAGCCAACGTTCCCAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132204876_1132204882 18 Left 1132204876 15:99979436-99979458 CCCAGAAACTGAGAGTCCACACA 0: 1
1: 0
2: 0
3: 10
4: 222
Right 1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG 0: 1
1: 0
2: 2
3: 52
4: 125
1132204877_1132204882 17 Left 1132204877 15:99979437-99979459 CCAGAAACTGAGAGTCCACACAA 0: 1
1: 0
2: 0
3: 4
4: 148
Right 1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG 0: 1
1: 0
2: 2
3: 52
4: 125
1132204879_1132204882 2 Left 1132204879 15:99979452-99979474 CCACACAAATGTGGTAGATGAAG 0: 1
1: 0
2: 2
3: 11
4: 162
Right 1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG 0: 1
1: 0
2: 2
3: 52
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132204882 Original CRISPR AAAAGCCAACGTTCCCAATG CGG Intronic
903860625 1:26362268-26362290 AATAACCAATGTTACCAATGAGG - Intronic
907834640 1:58097489-58097511 AACATCCCCCGTTCCCAATGAGG - Intronic
909743845 1:79067869-79067891 AAAACCCAACTTACCCTATGTGG - Intergenic
913069165 1:115284135-115284157 ACAAGCCAACCTTCCTGATGGGG + Intergenic
913939974 1:125093013-125093035 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
914891424 1:151627239-151627261 AAAAGCCAAGTTTCTCACTGTGG - Intronic
915301829 1:154956168-154956190 AAAAGTCAACTTCCCCAAGGGGG + Intergenic
916668056 1:166984952-166984974 AAAAGCCATCTTGCCCAAGGTGG + Intronic
917931894 1:179828381-179828403 CAAAGCCAACTTACCCAATATGG + Intergenic
920657078 1:207885281-207885303 AAAATCCAACTTTCCCACCGTGG - Intronic
921508480 1:216003474-216003496 AAAATGCCACCTTCCCAATGAGG - Intronic
1066780172 10:38936792-38936814 AGAAGCCCACGTTCCCAATGAGG + Intergenic
1067320874 10:45219678-45219700 AAAAGCCACCGTGGCCACTGGGG + Intergenic
1068147257 10:53087852-53087874 AAAAGCCAAAGTTGCCAAATGGG + Intergenic
1074575248 10:114662859-114662881 CATAGGCAACGTTCCCAAAGAGG + Intronic
1074584067 10:114749648-114749670 AAAAGCCAAAGTCCTCAAGGTGG + Intergenic
1078060024 11:8037260-8037282 CAAAGCCAAGGCTCCCAATATGG - Intronic
1079094305 11:17501087-17501109 AAACGACCACCTTCCCAATGGGG + Exonic
1080482143 11:32662698-32662720 AAAAGCCAACATTGACAATTGGG - Intronic
1080795577 11:35560012-35560034 AAAATGCTACCTTCCCAATGAGG - Intergenic
1085271171 11:75270857-75270879 AAACCCCCAGGTTCCCAATGAGG - Intronic
1086388007 11:86329315-86329337 AAAAGCCAAAATGCCCAATGAGG - Intronic
1086947217 11:92854734-92854756 AAAAGCCACTGTTCCAAAGGGGG - Intronic
1087910801 11:103751306-103751328 AAATGCCAAAGGTCACAATGAGG - Intergenic
1088238631 11:107751123-107751145 AGAAGCCAGCGTTCTCACTGTGG + Intergenic
1089171601 11:116515609-116515631 AAGAGCCAACGTGGCCAAGGAGG + Intergenic
1091595476 12:1875875-1875897 AAAAGCCAACCTTCCAAATGGGG + Intronic
1091929096 12:4380235-4380257 AAAAGCCAAAGTTGCCATTTTGG + Intergenic
1094177515 12:27556573-27556595 AACTGACAACTTTCCCAATGCGG - Intronic
1096577714 12:52564483-52564505 AAAAGACCACATTCCCAGTGAGG - Intergenic
1097029003 12:56078813-56078835 GAAAGCCAACCTCCCCAAAGCGG + Intergenic
1097395690 12:59071864-59071886 AAAAGTGCATGTTCCCAATGAGG + Intergenic
1109559799 13:64031949-64031971 AAAAGGCAACAGTCCAAATGTGG + Intergenic
1112161214 13:96870067-96870089 AAAAGACAACCTACACAATGGGG - Intergenic
1115444517 14:33474076-33474098 GAAAGCGAACGTTCCCTATGGGG - Intronic
1202937073 14_KI270725v1_random:99310-99332 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1123396126 15:19938433-19938455 AGAGGCCCACGTTCCCAGTGAGG + Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1126360873 15:47844542-47844564 AAAGGCCAACATTTCCCATGTGG + Intergenic
1127668465 15:61171703-61171725 TAAAGCTAAGATTCCCAATGGGG - Intronic
1130976756 15:88782448-88782470 AAAAGGCAGAGATCCCAATGAGG + Intergenic
1132204882 15:99979477-99979499 AAAAGCCAACGTTCCCAATGCGG + Intronic
1132417808 15:101636453-101636475 AACAGCCAGCGTGACCAATGAGG - Intronic
1134154664 16:11833087-11833109 AAAAACCAAGATTCCCAATTTGG - Intergenic
1136469010 16:30465985-30466007 ACAAGCCAAAGTTCTCACTGTGG - Intergenic
1136698598 16:32110588-32110610 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1136769009 16:32817246-32817268 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1136799099 16:33053882-33053904 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1136901590 16:34045080-34045102 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1136956786 16:34796832-34796854 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1137357076 16:47777253-47777275 AAAAGCCAAGGTTCCCACAATGG - Intergenic
1203071424 16_KI270728v1_random:1079353-1079375 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1143057584 17:4173806-4173828 AAAAGCCAACCTCCCCAGTGGGG + Intronic
1145692750 17:26760843-26760865 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1145709487 17:26957485-26957507 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1148129160 17:45252735-45252757 AAAGGCCACAGTTCACAATGGGG - Intergenic
1149743186 17:59068121-59068143 AAAAGCCAAAGTTTCCAATAAGG + Intronic
1152538768 17:80964422-80964444 AGCAGCCAACGTTCACACTGCGG - Exonic
1154518775 18:15203272-15203294 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1156274279 18:35567873-35567895 AAAAGCCAAGGTACAAAATGAGG + Intergenic
1157963895 18:52186823-52186845 AAAAGGCAACGTGACCACTGAGG - Intergenic
1157964003 18:52187874-52187896 AAAAGGCAACGTGACCACTGAGG - Intergenic
1162337012 19:10068009-10068031 AAAAGCCAAAGTCCTCACTGTGG - Intergenic
1167002158 19:46752125-46752147 AAAAGCCAAGGTACTCAATGTGG - Intronic
1167687245 19:50964008-50964030 CAAAGCCAAAGTTCTCAACGTGG + Intronic
1168048726 19:53812622-53812644 AAATGCCAACAGTGCCAATGTGG + Intronic
1202682751 1_KI270712v1_random:23760-23782 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
925531564 2:4868784-4868806 AGAAGCCAAAGTTCGAAATGTGG + Intergenic
928098019 2:28417394-28417416 AAAAACCAACTTTACCCATGAGG - Intergenic
928453416 2:31398665-31398687 AAAAGCCACGGCTCCCAGTGCGG - Exonic
929554682 2:42918532-42918554 AAAAAGCAACTTTCCCAATTAGG + Intergenic
931758199 2:65393188-65393210 AAAACCCAATGTTGCGAATGTGG + Intronic
934249050 2:90331415-90331437 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
934260527 2:91472059-91472081 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
934303845 2:91804010-91804032 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
934329409 2:92048741-92048763 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
934467628 2:94278658-94278680 AGGAGCCCACGTTCCCAGTGAGG - Intergenic
935735094 2:106100213-106100235 AAAATGCAAGGTTTCCAATGTGG - Intronic
935898581 2:107765028-107765050 AGAAGCCCAGGTTCCCAGTGAGG + Intergenic
938518775 2:132043773-132043795 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
938950901 2:136253715-136253737 ACAAGCCAGCCTTCCCAAAGAGG - Intergenic
943376422 2:187082857-187082879 AAAATCAAACGTTCTTAATGTGG + Intergenic
943646279 2:190409778-190409800 AAAAGCCAAGCTTCCCAAAGAGG - Intronic
946936855 2:224730963-224730985 AAAAGCCAAATTTCACCATGTGG - Intergenic
948925688 2:241095324-241095346 AAAAGCCAACTTCCCCAAACAGG + Exonic
1171340223 20:24421538-24421560 GGAAGCCAAAGTTCCCAAGGAGG - Intergenic
1173619175 20:44423624-44423646 AAAACCCCAAGTTCCCATTGTGG + Intronic
1173659411 20:44723039-44723061 AAAAGCCAAAGTCCCCACAGTGG + Intronic
1173916727 20:46713569-46713591 AAAAGCCAACGTCCTCACCGTGG - Intronic
1176586240 21:8589666-8589688 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1176722006 21:10400995-10401017 AGAGGCCAACGTTCCCAACCAGG - Intergenic
1176742944 21:10622386-10622408 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1177239173 21:18433967-18433989 AAAAGCCATTGTTGCCAATTTGG + Intronic
1179455917 21:41499923-41499945 ACAAGACCATGTTCCCAATGAGG + Intronic
1180269046 22:10566570-10566592 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1180303197 22:11053772-11053794 AGAGGCCAACGTTCCCAACCAGG - Intergenic
1184211200 22:43036579-43036601 AGAGGCCAACGTTCCCAACCAGG + Intergenic
1203289684 22_KI270735v1_random:23065-23087 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
951451780 3:22848334-22848356 AAAAGCCAAAATTGACAATGGGG - Intergenic
954286418 3:49622786-49622808 AGAAGCCCAGGTTCCCAGTGTGG + Intronic
954775727 3:53016399-53016421 AATGTCCAACCTTCCCAATGTGG + Intronic
956566431 3:70643804-70643826 ATCAGCCAACTTGCCCAATGTGG + Intergenic
957626347 3:82657517-82657539 AAAAGTAATCCTTCCCAATGAGG + Intergenic
959663852 3:108899847-108899869 AAAAGCCAAAGTTCTCAGAGTGG - Intergenic
960581119 3:119279620-119279642 AAGAGGCAACGTTCCCAAAGGGG + Intergenic
964853745 3:161122776-161122798 AAAAGCCAAAATTGACAATGGGG + Intronic
965132885 3:164723922-164723944 TAAAGCAAAAGTTCCCAGTGTGG + Intergenic
966439820 3:179931505-179931527 AAAAGTCAAACTTTCCAATGTGG - Intronic
968645999 4:1740792-1740814 AAAAGCAAACGTTCAGGATGAGG - Intronic
968804964 4:2766392-2766414 AAAAGCCAGAGTTCCCACGGTGG - Intergenic
970054881 4:11960214-11960236 AAAAGGCAACGTACAGAATGGGG - Intergenic
971367171 4:25986524-25986546 AAAACCCAAAGTCCCCACTGTGG + Intergenic
974617272 4:64306215-64306237 AAAAGACAAGCTTACCAATGAGG + Intronic
976120927 4:81780536-81780558 AAAAGCCAAACCTCCCACTGGGG + Intronic
977482389 4:97594614-97594636 AAAAGCCAACATTCACATTCAGG + Intronic
978052574 4:104220549-104220571 AAAAGCCACCCTCACCAATGTGG + Intergenic
981170851 4:141621469-141621491 AAAAGGCAAGGTTACAAATGTGG + Intergenic
981524419 4:145695611-145695633 AAAAGCCAAAGTTGACAAAGGGG - Intronic
982155246 4:152513574-152513596 AAAAAGCAACATTCCCAAAGAGG + Intronic
982989016 4:162246871-162246893 AAAAGCCAAAGTTGACAATTGGG - Intergenic
984761012 4:183362957-183362979 AAAAGCCAACATTCTCATTGCGG + Intergenic
984896342 4:184544364-184544386 AAAAGCCAAAGTTCTCAAACAGG + Intergenic
985108672 4:186524330-186524352 AAAAGCCAACGTTGACAAATGGG + Intronic
986947686 5:13044622-13044644 AAGAGCCACCCTTCCCAGTGTGG - Intergenic
987038585 5:14041038-14041060 AAAAGTCAAGGTGCTCAATGTGG - Intergenic
988689142 5:33554928-33554950 AAAAGGCAACGTTGCCTATGTGG + Intronic
990300472 5:54444800-54444822 AAAAACAGACGTTCCCAAAGTGG - Intergenic
991288892 5:65011606-65011628 GAAACCCAAAATTCCCAATGTGG - Intronic
992218012 5:74544662-74544684 AAAAGCCTATGATCCAAATGAGG + Intergenic
993086604 5:83370679-83370701 AAAAGTCAACAATCACAATGAGG - Intergenic
995323567 5:110865274-110865296 CAAAGCCAATGCTCCCAATCAGG - Intergenic
997214550 5:132099996-132100018 AAAAGCCATAGTTCCCACAGTGG + Intergenic
997800414 5:136855143-136855165 AAAAGCCAACAATATCAATGAGG + Intergenic
999308681 5:150537435-150537457 AAAGACAAACGTTCCCAAAGCGG - Intronic
1002125000 5:177036311-177036333 AAAAGCAAACATTCCCAATTTGG + Intronic
1004466419 6:15889480-15889502 CAAAGCCTTTGTTCCCAATGTGG + Intergenic
1006518702 6:34559006-34559028 AAAGGCCAACTTTCCCAATAAGG + Intergenic
1007159094 6:39774535-39774557 AAAAGCCAAGGATCAGAATGGGG + Intergenic
1007394717 6:41570861-41570883 AAAAGCCAGCTCTCCCACTGAGG - Intronic
1012575125 6:100786073-100786095 AAAACACAAAGTTCTCAATGGGG + Intronic
1014472580 6:121834670-121834692 AAGACCCAACTTTCCAAATGTGG - Intergenic
1018570311 6:165203325-165203347 TTAAGTCAACGTTCCCAATCAGG + Intergenic
1020501152 7:8922322-8922344 AAAAGTCAAAGTACACAATGAGG - Intergenic
1021736652 7:23645896-23645918 AAAATCCAAAGTTCCCACTGTGG + Intergenic
1022787260 7:33650864-33650886 AACAGCCACCTTTCCCAATGAGG + Intergenic
1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG + Intronic
1024804841 7:53126614-53126636 AGAAGCCCATGTTCCCAGTGTGG - Intergenic
1025307385 7:57874388-57874410 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1025481295 7:60986773-60986795 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1025838323 7:65118055-65118077 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1025878953 7:65515027-65515049 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1025884750 7:65577922-65577944 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1027511588 7:79088929-79088951 AAAAGCCAAAGTTGACAAAGGGG + Intronic
1030312195 7:108080080-108080102 AAAACCCAAGGTTATCAATGTGG - Intronic
1031760445 7:125707133-125707155 AAAAGCCATAGGTCCCATTGGGG - Intergenic
1031881317 7:127201865-127201887 AAAAACCATTGTTCCAAATGTGG + Intronic
1032722921 7:134565507-134565529 AAAAGCCAAGATGCCCATTGTGG + Intronic
1034594518 7:152176989-152177011 AAAATCCACTGTTACCAATGAGG - Exonic
1036501825 8:9321135-9321157 AAAAGTCAACTTTCCTGATGAGG + Intergenic
1041470928 8:58208245-58208267 AAATCCCAACACTCCCAATGTGG - Intergenic
1043997158 8:86832277-86832299 AATAGACAACATTCCTAATGTGG + Intergenic
1046634914 8:116663584-116663606 AAAAGCAAACATCCCCACTGAGG + Intronic
1047609416 8:126506446-126506468 AAAAGCCAACGTTTGCTCTGAGG - Intergenic
1049253657 8:141602734-141602756 GTAAGCCACCGTTCCGAATGGGG - Intergenic
1051680864 9:19606564-19606586 AAAGGAGAACATTCCCAATGGGG + Intronic
1053698043 9:40656730-40656752 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1053944054 9:43286938-43286960 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1054309334 9:63456138-63456160 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1054408130 9:64780260-64780282 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1054441276 9:65264086-65264108 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1054489001 9:65757403-65757425 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1056945853 9:90996001-90996023 AAGAGACAACGTTCCCAGTGTGG + Intergenic
1060459145 9:123832443-123832465 AAATGCCAAGTTTTCCAATGTGG - Intronic
1061917870 9:133765413-133765435 AAGTGCCAACGTCCCCATTGTGG + Intronic
1202780407 9_KI270717v1_random:29920-29942 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1203582116 Un_KI270746v1:18086-18108 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1203587189 Un_KI270747v1:15516-15538 AGAAGCCCACGTTCCCAGTGAGG - Intergenic
1203616148 Un_KI270749v1:67181-67203 AGAAGCCCACGTTCCCAGTGAGG + Intergenic
1190116284 X:47627910-47627932 AAAAGCCAACGTCCTCTCTGTGG + Intronic
1196324181 X:114382639-114382661 AAAAGTCAACCTTTCCAATGTGG - Intergenic