ID: 1132210367

View in Genome Browser
Species Human (GRCh38)
Location 15:100017429-100017451
Sequence GGCTGAACACCACAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 452}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132210367_1132210384 28 Left 1132210367 15:100017429-100017451 CCTTCTCCCTGTGGTGTTCAGCC 0: 1
1: 1
2: 2
3: 39
4: 452
Right 1132210384 15:100017480-100017502 CCTGTGGTGCCAGGCAGGAATGG 0: 137
1: 146
2: 97
3: 112
4: 610
1132210367_1132210372 2 Left 1132210367 15:100017429-100017451 CCTTCTCCCTGTGGTGTTCAGCC 0: 1
1: 1
2: 2
3: 39
4: 452
Right 1132210372 15:100017454-100017476 TCCTCTGGCCTCCCTCCCGATGG 0: 1
1: 21
2: 101
3: 185
4: 472
1132210367_1132210375 12 Left 1132210367 15:100017429-100017451 CCTTCTCCCTGTGGTGTTCAGCC 0: 1
1: 1
2: 2
3: 39
4: 452
Right 1132210375 15:100017464-100017486 TCCCTCCCGATGGATCCCTGTGG 0: 1
1: 17
2: 105
3: 124
4: 197
1132210367_1132210380 19 Left 1132210367 15:100017429-100017451 CCTTCTCCCTGTGGTGTTCAGCC 0: 1
1: 1
2: 2
3: 39
4: 452
Right 1132210380 15:100017471-100017493 CGATGGATCCCTGTGGTGCCAGG 0: 17
1: 96
2: 155
3: 98
4: 181
1132210367_1132210381 23 Left 1132210367 15:100017429-100017451 CCTTCTCCCTGTGGTGTTCAGCC 0: 1
1: 1
2: 2
3: 39
4: 452
Right 1132210381 15:100017475-100017497 GGATCCCTGTGGTGCCAGGCAGG 0: 130
1: 140
2: 109
3: 79
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132210367 Original CRISPR GGCTGAACACCACAGGGAGA AGG (reversed) Intronic
900073574 1:793483-793505 AGCTGAAGAGAACAGGGAGAGGG - Intergenic
900084690 1:886330-886352 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
900535553 1:3175448-3175470 CCCTGAACAAAACAGGGAGAGGG - Intronic
900645140 1:3705609-3705631 GGCTGGAGCACACAGGGAGAGGG + Intronic
901650211 1:10738701-10738723 GCGTAAACCCCACAGGGAGAGGG + Intronic
902391679 1:16110827-16110849 GGCTGAAGACCACAGGGTTGGGG + Intergenic
904475544 1:30762397-30762419 GGCTGAAGGCTCCAGGGAGATGG + Intergenic
904884613 1:33726667-33726689 AGGTGACCACCACAGGGAGCTGG + Exonic
905276968 1:36824692-36824714 GGCTGGAGCCCAGAGGGAGAAGG + Intronic
906283039 1:44566891-44566913 CTCTGAAAACCACAGGGGGATGG - Intronic
906670314 1:47649486-47649508 GGCTGAACACCTGAGCGTGAAGG + Intergenic
906970621 1:50509734-50509756 GGCCGAACAGTACAGGGAAAAGG + Intronic
907517010 1:54999144-54999166 GCCTGCACACCCCCGGGAGAGGG - Exonic
908095201 1:60730234-60730256 GCCTGAATTCCAAAGGGAGAAGG - Intergenic
908795960 1:67832264-67832286 CTCTGAACACCAGAGGTAGAAGG - Intronic
908820149 1:68077844-68077866 GGGAAAAGACCACAGGGAGAAGG - Intergenic
909443140 1:75720136-75720158 GGTTGTATACCACAGGGAAAGGG - Intergenic
909860082 1:80594082-80594104 GGAGAAAGACCACAGGGAGAAGG + Intergenic
910739070 1:90495082-90495104 GGGGAAACACCACAGGGAGAAGG - Intergenic
910768792 1:90809933-90809955 GGCTGAACATTATATGGAGAAGG - Intergenic
911563628 1:99436055-99436077 TTTTGAAAACCACAGGGAGAAGG - Intergenic
912195255 1:107390166-107390188 GGCTGAACACTGCAAGTAGAGGG - Intronic
913336690 1:117715562-117715584 GGGAAAAGACCACAGGGAGAAGG + Intergenic
913971885 1:143422655-143422677 TCCTGGACACCACAGGGAGCTGG + Intergenic
914066264 1:144248268-144248290 TCCTGGACACCACAGGGAGCTGG + Intergenic
914112889 1:144718086-144718108 TCCTGGACACCACAGGGAGCTGG - Intergenic
914953218 1:152137471-152137493 GGCAGAACATTCCAGGGAGAAGG - Intergenic
916863989 1:168836784-168836806 GGCTGGGCATCAGAGGGAGACGG - Intergenic
918526689 1:185472496-185472518 GGCTCAGTGCCACAGGGAGAAGG + Intergenic
919397372 1:197068384-197068406 GGGAAAAGACCACAGGGAGAAGG + Intergenic
920068685 1:203287384-203287406 GGCTGGTCCCCACAGGGAGGAGG + Intergenic
922207060 1:223457011-223457033 TGCTAAAAACCACATGGAGAGGG - Intergenic
922673474 1:227532798-227532820 GGTAAAACTCCACAGGGAGAAGG - Intergenic
922895104 1:229093801-229093823 GCCTGAACTCCAAAGGGAGGAGG - Intergenic
923150043 1:231224714-231224736 GAAGGAAAACCACAGGGAGAAGG - Intronic
923161156 1:231316066-231316088 GCCAGAAAACCACAGGGGGATGG + Intergenic
923961186 1:239085238-239085260 GGGAAAAGACCACAGGGAGAAGG - Intergenic
924205443 1:241707067-241707089 GGTATGACACCACAGGGAGAAGG - Intronic
1062761824 10:28289-28311 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1062867872 10:872229-872251 GGCTGAACGCCACAGGCTCAGGG + Intronic
1063450714 10:6148223-6148245 GGCTGAACTCCGCATGGAGAGGG + Intronic
1064452490 10:15455200-15455222 GCCTGAATACCAAAGGGAGGAGG - Intergenic
1065731544 10:28713830-28713852 TGCTGGACAGCACAGGGAAAAGG - Intergenic
1065755303 10:28925165-28925187 GGCTGCGCACCAGAGGGAGGCGG + Intergenic
1066062817 10:31739237-31739259 GCCTGAATTCCAAAGGGAGAGGG + Intergenic
1066472680 10:35714326-35714348 GGCTGAACACTAAAGGGCCATGG + Intergenic
1066758827 10:38736475-38736497 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
1067169883 10:43897895-43897917 GGCGGAACACCAGAGGCACACGG + Intergenic
1067844205 10:49706549-49706571 GGTTGCACAGCACTGGGAGAAGG + Intronic
1069150587 10:64954298-64954320 GGGAAAACACCACAGGGAGAAGG - Intergenic
1069325208 10:67224802-67224824 GGGGAAGCACCACAGGGAGAAGG + Intronic
1069552893 10:69376765-69376787 GACTGAACAGCAGAGGGAGAGGG - Intronic
1070459578 10:76650863-76650885 AGCTGAACACTTCAGAGAGAAGG + Intergenic
1070464861 10:76711386-76711408 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1071484666 10:86091063-86091085 GGTAAAACTCCACAGGGAGAAGG + Intronic
1072338717 10:94424709-94424731 GTCTGAAGGCCACATGGAGATGG + Intronic
1072885130 10:99266053-99266075 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1073700811 10:105925069-105925091 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1075741955 10:124701455-124701477 GGCTGAAGACCAAAGGGAGCTGG - Intronic
1075866564 10:125726890-125726912 GACAGAACAACACTGGGAGATGG - Intronic
1076811992 10:132891361-132891383 GCCTGAGCTCCAAAGGGAGAGGG - Intronic
1076904047 10:133353523-133353545 GGCTGAACACGGCAGGATGAGGG - Intergenic
1077828062 11:5831837-5831859 GGGGAAAGACCACAGGGAGAAGG - Intronic
1077929115 11:6711962-6711984 GGCACAGCATCACAGGGAGACGG - Intergenic
1078288513 11:9983003-9983025 GGTAAAACTCCACAGGGAGAAGG + Intronic
1078318312 11:10309830-10309852 GGCTGAACAGCCAAGGGTGAAGG + Intronic
1078377049 11:10804874-10804896 GGCTTAACTCAAAAGGGAGAGGG - Intronic
1079806136 11:24932883-24932905 GGGAAAAGACCACAGGGAGAAGG - Intronic
1080672623 11:34395146-34395168 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1080839481 11:35970983-35971005 GGCTGAGCACCAGGGAGAGATGG - Intronic
1081195194 11:40152369-40152391 GGTAAAACTCCACAGGGAGAAGG + Intronic
1082722371 11:56694226-56694248 TGGGGAAGACCACAGGGAGAAGG + Intergenic
1083072783 11:60003616-60003638 GGGAAAACACCACAGGGAGAAGG + Intergenic
1083115807 11:60458183-60458205 GGCTGAAAAGCACAGAGGGAAGG + Intronic
1083349199 11:62015230-62015252 CACTGAACTCCACAGGGAGAGGG + Intergenic
1083493817 11:63033207-63033229 GGAAGAACACCATATGGAGATGG - Intergenic
1083828720 11:65217678-65217700 GGCTGGACTCACCAGGGAGACGG - Intergenic
1085742367 11:79088213-79088235 GGCTGAAACCCAGAGGGTGATGG + Intronic
1085747737 11:79129301-79129323 GGGGGAACTCCACAGGGAGAAGG + Intronic
1086825499 11:91490258-91490280 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1087206806 11:95404809-95404831 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1087317057 11:96615131-96615153 TGCTGAGCTCCCCAGGGAGACGG - Intergenic
1087619411 11:100525251-100525273 GGGAAAACACCACAGGGAGAAGG + Intergenic
1088239452 11:107758616-107758638 GGGTAAACACCACAGGGAGAAGG + Intergenic
1088823700 11:113476423-113476445 GGCACAACACTCCAGGGAGAGGG + Intergenic
1089314709 11:117583602-117583624 GGCAGACCTGCACAGGGAGAGGG - Intronic
1090650850 11:128804649-128804671 GGCTGATGACCACAGAGAAAGGG - Intronic
1090701784 11:129302719-129302741 GGCTGAAGTCAACAGGGAGCAGG - Intergenic
1090757249 11:129803424-129803446 GGTTAAACTCCACAAGGAGAAGG + Intergenic
1091210594 11:133854869-133854891 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1091311460 11:134578044-134578066 GGCTGCAAACCAGAGGGACAGGG - Intergenic
1091487920 12:907609-907631 GGCTGAACAACTCAGGATGACGG - Intronic
1092468950 12:8761525-8761547 GCCTGAAGAGCACAGGGGGAGGG - Intronic
1093720505 12:22437028-22437050 GGTAAAACTCCACAGGGAGAAGG + Intronic
1094263526 12:28528165-28528187 GGAAAAAAACCACAGGGAGAAGG - Intronic
1094811562 12:34143232-34143254 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1095892706 12:47249698-47249720 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1095947186 12:47759838-47759860 GGCTCAACAGCAAAGGGAAAAGG - Intronic
1096749901 12:53751986-53752008 GTCTGACAACCACGGGGAGAGGG - Intergenic
1097295409 12:57957813-57957835 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1097760466 12:63459105-63459127 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1098500537 12:71187120-71187142 GGGAAAAGACCACAGGGAGAAGG + Intronic
1098960994 12:76739552-76739574 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1099473104 12:83074938-83074960 GGTAAAACTCCACAGGGAGAAGG - Intronic
1100291065 12:93215304-93215326 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1100660589 12:96694301-96694323 GCTTGAACACCACATGGAGTGGG + Intronic
1101290317 12:103361450-103361472 GGGAAAAGACCACAGGGAGAAGG + Intronic
1101635351 12:106535830-106535852 GGGGAAACACTACAGGGAGAAGG - Intronic
1101814352 12:108134317-108134339 GGCCGAACCCCAAAGGGAGGGGG - Intronic
1102203463 12:111074534-111074556 AGCTGAAGGCCACAGGCAGAGGG - Intronic
1102306968 12:111812229-111812251 AGCACAGCACCACAGGGAGACGG + Intergenic
1102352942 12:112208074-112208096 GGGTGAAGACCTCAGGGTGAGGG - Intronic
1103417419 12:120752388-120752410 CGCTGCACACCACAGCCAGAGGG - Intergenic
1103901156 12:124304213-124304235 GGCTGGACACCAAGGGAAGATGG - Intronic
1104230921 12:126883236-126883258 AGCTGATCTCCAAAGGGAGAGGG + Intergenic
1106392319 13:29346731-29346753 GGGGAAAGACCACAGGGAGAAGG - Intronic
1107085063 13:36418325-36418347 CCCAGAACACCTCAGGGAGATGG + Intergenic
1107742926 13:43472630-43472652 GGCTAAATACCAGATGGAGAAGG - Intronic
1108469856 13:50756780-50756802 GGGAAAACACCACAGGAAGAAGG - Intronic
1108572907 13:51768351-51768373 GCCTGAGCAGCACAGGGACATGG - Intronic
1109048005 13:57438043-57438065 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1109508467 13:63337238-63337260 GGGGGAATGCCACAGGGAGAAGG - Intergenic
1109945226 13:69423682-69423704 GGGGAAAGACCACAGGGAGAAGG + Intergenic
1110718318 13:78732847-78732869 GCCTGAATTCCAGAGGGAGAAGG - Intergenic
1111225524 13:85266327-85266349 GGGGAAAGACCACAGGGAGAAGG + Intergenic
1112945242 13:104919922-104919944 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1113240186 13:108328535-108328557 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1113329884 13:109317537-109317559 GGGAAATCACCACAGGGAGAAGG + Intergenic
1113472468 13:110556722-110556744 GCCTGGGCAACACAGGGAGACGG - Intronic
1113939481 13:114010870-114010892 GGCTGAACAGGCCAGGCAGATGG - Intronic
1115176039 14:30562700-30562722 AGCACAGCACCACAGGGAGACGG - Intronic
1115996846 14:39203784-39203806 GGGAAAACACCACAGGGAGAAGG + Intergenic
1116806764 14:49501372-49501394 GGGAGAACGCCACAGGTAGAAGG + Intergenic
1117510854 14:56449196-56449218 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1117768409 14:59107417-59107439 GGCAAAAGGCCACAGGGAGAAGG + Intergenic
1118380422 14:65213534-65213556 GCCTGAATTCCACAGGGAGGAGG + Intergenic
1118866832 14:69711028-69711050 TGCTCAATCCCACAGGGAGAGGG - Exonic
1119199019 14:72739496-72739518 TGCTGAAAAGCACAAGGAGAGGG - Intronic
1119514948 14:75240679-75240701 GGCTGATCACCATGGTGAGATGG - Intronic
1119648706 14:76367858-76367880 GTCTGAGCACCACAAGGAGGGGG - Intronic
1121503546 14:94459076-94459098 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1121516680 14:94556793-94556815 GGCAAAATGCCACAGGGAGAAGG - Intergenic
1122337582 14:101004157-101004179 GACTGAACAGCAAAGGCAGAAGG - Intergenic
1122351435 14:101095584-101095606 GCCTGAACCCCAAAGGGAGGAGG - Intergenic
1122988600 14:105225420-105225442 GCCTGAACTCCAAAGGGAGGGGG - Intronic
1123442255 15:20301172-20301194 GGCTGCACTCCTCAGGGAGTAGG - Intergenic
1124557053 15:30736033-30736055 GGAAAAACACCACAGAGAGAAGG + Intronic
1124674205 15:31669711-31669733 GGAAAAACACCACAGGGAGAAGG - Intronic
1125324347 15:38521537-38521559 GGCTGCCCCCCACAGGGAGCAGG + Intronic
1125454435 15:39842937-39842959 GGATGAAACCCACAGGGTGATGG - Intronic
1126577426 15:50210565-50210587 GGCAAAACTCCACAGGGAGAAGG + Intronic
1126942854 15:53784989-53785011 GGCTGCACACAGCAAGGAGAGGG + Intergenic
1127031073 15:54863511-54863533 GGCAAAACTCCACGGGGAGAAGG + Intergenic
1127861112 15:62994909-62994931 GGCTGAACTCCACAAAGGGAAGG - Intergenic
1128034031 15:64507414-64507436 GAGTGAAAACCACAGAGAGAGGG - Intronic
1128326559 15:66727603-66727625 GAATGAGCCCCACAGGGAGAGGG + Intronic
1128443651 15:67737794-67737816 TGGTGACCACCACGGGGAGAAGG + Intronic
1129097667 15:73225853-73225875 GGAAAAACACCACAGGGAGAAGG - Intronic
1129244153 15:74269597-74269619 GGCCGCACCCCACAGGGAGGAGG + Intronic
1129281714 15:74490202-74490224 GGCTAAATAACTCAGGGAGAAGG - Intergenic
1129562824 15:76589749-76589771 GGGAAAAGACCACAGGGAGAAGG - Intronic
1132210367 15:100017429-100017451 GGCTGAACACCACAGGGAGAAGG - Intronic
1132599937 16:768908-768930 GGCGCAAGACCAGAGGGAGAGGG - Intergenic
1133856287 16:9552194-9552216 GGCAGAACATCATAGGCAGAGGG + Intergenic
1135562638 16:23488253-23488275 GGCTGTGCACAAAAGGGAGAGGG + Intronic
1136217237 16:28802686-28802708 GGAGGAACACCACAGGAGGAAGG + Intergenic
1138798048 16:59993589-59993611 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1139098854 16:63740775-63740797 GACTGAACAGGACAGGGAAAAGG + Intergenic
1139272900 16:65700094-65700116 GAATGAGCAACACAGGGAGAGGG - Intergenic
1140237331 16:73171370-73171392 GGCTGAAAGCCTCAGGCAGAAGG + Intergenic
1141036680 16:80632783-80632805 GGATGAAGACCATGGGGAGAGGG - Intronic
1142553669 17:757154-757176 GCCTGAACAACGCAGTGAGACGG + Intronic
1142588086 17:987183-987205 GGCTGATCACCCCAGGGAATGGG + Intergenic
1142588113 17:987278-987300 GGCTGATCACCCCAGGGATTGGG + Intergenic
1142588123 17:987307-987329 GGCTGATCACCCCAGGGAATGGG + Intergenic
1142588135 17:987344-987366 GGCTGATCACCCCAGGGAATGGG + Intergenic
1142588162 17:987439-987461 GGCTGATCACCCCAGGGATTGGG + Intergenic
1142588184 17:987505-987527 GGCTGATCACCCCAGGGAATGGG + Intergenic
1142588205 17:987571-987593 GGCTGATCACCGCAGGGAATGGG + Intergenic
1142841124 17:2631434-2631456 GGTAAAACCCCACAGGGAGAAGG - Intronic
1143272282 17:5684615-5684637 GGGTGAACCTCACAGGTAGAAGG - Intergenic
1144044945 17:11446986-11447008 GGAGGAAAACCACAGAGAGAAGG - Intronic
1145241050 17:21241270-21241292 GGCTGGAGGCCACAGGGACATGG + Exonic
1145243017 17:21250668-21250690 AGCCACACACCACAGGGAGAGGG - Intronic
1146400485 17:32496949-32496971 GTCTGAACACGAGAGGGTGAGGG - Intronic
1146609418 17:34291138-34291160 GGCTGAACCCCTCAGGGATGAGG - Intergenic
1147052724 17:37808401-37808423 GGCTGAACAGAACTGAGAGAGGG - Intergenic
1147278262 17:39337016-39337038 GGCTCAGCATCAGAGGGAGACGG - Intronic
1148401139 17:47362611-47362633 AGCACAACACCACAGGGAGACGG - Intronic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149221341 17:54418252-54418274 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1149875049 17:60224233-60224255 GGCTGCATACCACAGGCAGAAGG - Intronic
1150566764 17:66348761-66348783 GGTTGAACAGCAGAGGGGGAGGG + Intronic
1152522437 17:80865328-80865350 GACTGAACGCCACAATGAGAAGG + Intronic
1152954731 18:28619-28641 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1153065376 18:1039431-1039453 GGGAAAACGCCACAGGGAGAAGG + Intergenic
1153966010 18:10182511-10182533 GGCAAAACACCACAGGAAGAAGG - Intergenic
1154094017 18:11393519-11393541 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1158603091 18:58871524-58871546 GGCAGAACAGCACAGTGAGAAGG - Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1158756424 18:60331509-60331531 GGTAAAACTCCACAGGGAGATGG + Intergenic
1159787024 18:72726790-72726812 GGAAAAACGCCACAGGGAGAAGG + Intergenic
1161788891 19:6346699-6346721 GGCTGACCACCAGATGTAGATGG - Intergenic
1162186359 19:8907856-8907878 GGGTGAACAGCACCAGGAGAGGG + Exonic
1164267377 19:23632540-23632562 GGTAAAACTCCACAGGGAGAAGG + Intronic
1165491058 19:36122964-36122986 GGCTGAAGACGACTGGGGGATGG - Intronic
1166012551 19:39953371-39953393 GGCTGCACCCCAAAGGGAGCAGG + Intergenic
1166334797 19:42099355-42099377 GGCTGACCCAGACAGGGAGATGG + Intronic
1167234265 19:48304133-48304155 GGCTGACCCCCGCAGGGAGGAGG - Exonic
1168368942 19:55814892-55814914 GGCTCCTGACCACAGGGAGATGG + Intronic
1168458469 19:56534176-56534198 GGGAAAACACCAAAGGGAGAAGG - Intergenic
925055342 2:852989-853011 TCCTGAACTCCACAGGGAGGAGG + Intergenic
926012092 2:9416529-9416551 GGCTGAAGACCCCTGGGAGTGGG - Intronic
926038842 2:9656568-9656590 GGCTGAGCACAGCAGGGAAAGGG - Intergenic
926688954 2:15719577-15719599 GGATGAAACACACAGGGAGATGG - Intronic
928356580 2:30621826-30621848 GGGGAAAGACCACAGGGAGAAGG + Intronic
929762591 2:44818354-44818376 GGCTGCCCACCACATGCAGAAGG - Intergenic
930486572 2:52018202-52018224 TGGAGAACACTACAGGGAGAAGG - Intergenic
931547811 2:63408510-63408532 GGTAAAACTCCACAGGGAGAAGG + Intronic
931981239 2:67695862-67695884 GGCTTCACACCATAGGGGGATGG + Intergenic
932851247 2:75189211-75189233 GGCAGAACTCCACTGTGAGAGGG + Intronic
934176576 2:89583587-89583609 TCCTGGACACCACAGGGAGCTGG + Intergenic
934238031 2:90248271-90248293 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
934286886 2:91657948-91657970 TCCTGGACACCACAGGGAGCTGG + Intergenic
935007051 2:99089325-99089347 GGGAAAAGACCACAGGGAGAAGG + Intronic
935361479 2:102250231-102250253 GGCGGGACACCCCAGGGAGAAGG - Intergenic
936063552 2:109313642-109313664 GGCTCAACATCCCAGGGGGATGG + Intronic
937767703 2:125680559-125680581 GGTAAAACTCCACAGGGAGAAGG - Intergenic
938312520 2:130302273-130302295 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
939136190 2:138297326-138297348 GAGTGAGCACCACAGGGAGGAGG + Intergenic
939605814 2:144253958-144253980 GGCTGCACACAGCAGGGAGCAGG - Intronic
939610951 2:144310198-144310220 GGATGAACATTACAGGCAGAGGG + Intronic
940034780 2:149302146-149302168 GGTAAAACTCCACAGGGAGAAGG - Intergenic
940172442 2:150843445-150843467 GGTAAAACTCCACAGGGAGAAGG - Intergenic
940709458 2:157144381-157144403 GGGGAAACACCACAGGGAGAAGG - Intergenic
940993958 2:160126986-160127008 GCCTGAATTCCAAAGGGAGAAGG - Intronic
941149604 2:161897367-161897389 GGCTGAACTCCACAGGGCAAGGG - Intronic
945132166 2:206584802-206584824 GGTAAAACTCCACAGGGAGAAGG - Intronic
945544064 2:211127066-211127088 AGCTGAACAAAACAGAGAGAAGG - Intergenic
946681864 2:222225859-222225881 GGCTGGACACCACAGAGTGAAGG - Intronic
946913549 2:224490609-224490631 GGCTGGACCCTACAGGGTGATGG + Intronic
947850225 2:233281678-233281700 GGACGGACACCACAGGCAGAGGG + Intronic
948531126 2:238606329-238606351 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1169517539 20:6333597-6333619 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1170375892 20:15699817-15699839 GGTAAAACTCCACAGGGAGAAGG - Intronic
1170721094 20:18879696-18879718 GGAAAAACATCACAGGGAGAAGG - Intergenic
1170863229 20:20128249-20128271 GGAAAAACACCACGGGGAGAAGG - Intronic
1171185014 20:23118917-23118939 GTGTCAAGACCACAGGGAGATGG - Intergenic
1171378711 20:24715230-24715252 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1171774789 20:29355190-29355212 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1172276904 20:33685029-33685051 GGCTGAATTCCAGTGGGAGAAGG - Intronic
1172287350 20:33750147-33750169 GCCTGGACAACAAAGGGAGATGG - Intronic
1172804471 20:37601549-37601571 CACAGAACATCACAGGGAGAAGG - Intergenic
1172980595 20:38938688-38938710 GGCTGAGGATGACAGGGAGAGGG - Intronic
1173017546 20:39239240-39239262 GGCTGAACCCCAGAGAGATATGG - Intergenic
1173844497 20:46179276-46179298 GACTGAAGACCGCGGGGAGAAGG - Intronic
1174716696 20:52766447-52766469 TGTTGAACGCCAGAGGGAGAGGG + Intergenic
1174913876 20:54635089-54635111 GCCTGAACTCCAAAGGGAGGAGG - Intronic
1175412225 20:58777803-58777825 GGAAGAACACCCCAGGAAGAGGG - Intergenic
1176152314 20:63598118-63598140 GGCTGACCACACCAGGTAGAAGG + Intronic
1177195667 21:17901255-17901277 GGAAAAACACCACAGGGAGAAGG - Intronic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1179084280 21:38203546-38203568 GGCAAAAGACCACAGGGAGAAGG - Intronic
1180105872 21:45617691-45617713 GGCTGAGCAGCAGAGGGAGCTGG - Intergenic
1180320267 22:11313428-11313450 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1181278206 22:21700278-21700300 CTCTGAAGACCACAGGGACAGGG - Exonic
1181979142 22:26753584-26753606 GGCAGAACACTCCAGAGAGAAGG - Intergenic
1182638646 22:31749821-31749843 GGCGGAACGACCCAGGGAGAGGG - Intronic
1182739133 22:32554155-32554177 GGCTGAACGCAAAAGAGAGATGG - Intronic
1183173932 22:36208524-36208546 GGCTGATGGCCACAGGGAGCTGG + Intergenic
1183464175 22:37971174-37971196 GGCTGCAAACCACAGGCAGGTGG + Intronic
1183909015 22:41064609-41064631 GGCTGGAGACCACAAGGAGGAGG + Intergenic
1184933353 22:47698437-47698459 GCCTGAACTCCAAAGGGAGGAGG + Intergenic
1185218460 22:49616888-49616910 GGCTGGAGACCACTGGGACAGGG - Intronic
949377297 3:3404898-3404920 GGGAAAAGACCACAGGGAGAAGG + Intergenic
953084594 3:39654364-39654386 GGTAAAACTCCACAGGGAGAAGG - Intergenic
953091809 3:39734876-39734898 GGCTGAAAATCAAAGGGCGAAGG - Intergenic
953294159 3:41696208-41696230 AGCATAGCACCACAGGGAGATGG - Intronic
955407984 3:58637507-58637529 GGGTGACCACCACTGGTAGAAGG + Intronic
956068834 3:65426040-65426062 GACTGGACAGCAGAGGGAGAAGG + Intronic
957016464 3:75069860-75069882 CGGGGAACACCACAGGGAGAGGG - Intergenic
958490561 3:94766711-94766733 GGGAAAACACCATAGGGAGATGG - Intergenic
958787493 3:98613466-98613488 GGGGAAAGACCACAGGGAGAAGG - Intergenic
959046918 3:101484805-101484827 GGTATAACTCCACAGGGAGAAGG + Intronic
959279717 3:104323057-104323079 GAGGAAACACCACAGGGAGAAGG + Intergenic
959291044 3:104474885-104474907 GGCTGTTCAGCACTGGGAGAGGG - Intergenic
959867973 3:111292716-111292738 GGGGAAAGACCACAGGGAGAGGG - Intronic
960016067 3:112889519-112889541 GGTAAAACTCCACAGGGAGAAGG - Intergenic
960614052 3:119580750-119580772 ACCTGAAAGCCACAGGGAGAAGG + Intronic
961794257 3:129398230-129398252 GCCTGAATTCCATAGGGAGAAGG - Intergenic
961978153 3:131048359-131048381 GGGAAAAGACCACAGGGAGAAGG - Intronic
962580235 3:136791417-136791439 GGCTGAGCACCAAAGAGAGATGG + Intergenic
962673818 3:137736720-137736742 GGATAAAGCCCACAGGGAGAAGG - Intergenic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
964188924 3:153980007-153980029 GGGTGAACACCACAGGGAGAAGG + Intergenic
964601331 3:158503939-158503961 GGAAAAACACCACAGGGAGAAGG - Intronic
964922215 3:161911012-161911034 GGCTGAAGAAGAAAGGGAGATGG - Intergenic
965058521 3:163753170-163753192 GGCAGAGCACCACACTGAGAGGG + Intergenic
966153594 3:176892360-176892382 GGCTCAACACCACATGGAAGCGG - Intergenic
966962577 3:184954692-184954714 GGCTGAAAACTACAGGGACTAGG - Intronic
967062105 3:185881652-185881674 GGCTGAGCAGAACAGGAAGAGGG + Intergenic
967335182 3:188336666-188336688 GGCTGTATGCCACAGGGAGAGGG + Intronic
968108569 3:196022464-196022486 GGCACAGCATCACAGGGAGACGG - Intergenic
968284929 3:197502926-197502948 GGCTTAGCACCTCAGGGGGATGG - Intergenic
968358991 3:198133520-198133542 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
968443569 4:636673-636695 GGCAGAACAAGACACGGAGAAGG - Intronic
968646586 4:1744164-1744186 GGCTCAGCTCCAGAGGGAGACGG + Intronic
968925295 4:3543940-3543962 GCCTGAGCAACATAGGGAGATGG + Intergenic
969444857 4:7239005-7239027 TGCTGAACTCCACAGGGACGTGG - Intronic
970312001 4:14792733-14792755 GGGAAAACACCACAGGGAGAAGG + Intergenic
970346650 4:15159158-15159180 GGTAAAACTCCACAGGGAGAAGG - Intergenic
971154178 4:24064437-24064459 GGATGCACACCACAGGCTGAGGG + Intergenic
971183197 4:24349865-24349887 GGTAAAACTCCACAGGGAGAAGG - Intergenic
971471496 4:27031664-27031686 GGCTGAAGATCACAGGGAGGGGG - Intergenic
973554753 4:52071896-52071918 GCCTGAACAGCAAAGAGAGAGGG - Exonic
973782331 4:54300360-54300382 GGTAAAACTCCACAGGGAGAAGG + Intergenic
974474515 4:62361960-62361982 GGAAAAACACCACAGGGAGAAGG - Intergenic
975020027 4:69474781-69474803 GGGAAAAGACCACAGGGAGAAGG - Intergenic
976686411 4:87819823-87819845 GGTAAAACTCCACAGGGAGAAGG - Intergenic
977746722 4:100558319-100558341 GGTAAAACTCCACAGGGAGAAGG + Intronic
977852552 4:101847924-101847946 GGTAAAACTCCACAGGGAGAAGG - Intronic
978689193 4:111485861-111485883 GGCTAAACACCCCAGTGAAAAGG + Intergenic
980874511 4:138647672-138647694 GGCTGAACACCACTGGGAGGTGG - Intergenic
980883537 4:138738826-138738848 GGCTGGGCATCAGAGGGAGACGG - Intergenic
981153960 4:141412442-141412464 GGCAGGTCTCCACAGGGAGAGGG - Intergenic
982630476 4:157823947-157823969 GGGAAAACGCCACAGGGAGAAGG + Intergenic
982630675 4:157825142-157825164 GGGAAAACACCATAGGGAGAAGG + Intergenic
984527624 4:180875819-180875841 GGTAAAACTCCACAGGGAGAAGG - Intergenic
985055547 4:186032762-186032784 GGCTGGATGCCACAGGGAGGAGG + Intergenic
985092807 4:186381549-186381571 GGTAAAACTCCACAGGGAGAAGG + Intergenic
985217848 4:187672298-187672320 GGTAAAACTCCACAGGGAGAAGG - Intergenic
985240881 4:187929793-187929815 GGGAGAAGGCCACAGGGAGAAGG - Intergenic
985355670 4:189116566-189116588 GGGGAAAGACCACAGGGAGAAGG + Intergenic
986683002 5:10250565-10250587 GGCCGGAGACCGCAGGGAGACGG - Intronic
987030480 5:13972404-13972426 GGGGAAAGACCACAGGGAGAAGG - Intergenic
989574594 5:42978727-42978749 GGCTGGGCATCAGAGGGAGACGG - Intergenic
992426367 5:76662151-76662173 GTCAGAACCTCACAGGGAGAAGG + Intronic
992776958 5:80097270-80097292 GTTTGAACACCACGGGAAGAGGG - Intergenic
993471762 5:88315050-88315072 GAGTGAACACCAAAGGCAGAGGG - Intergenic
993883943 5:93395140-93395162 TGGGGAACACCACAGGGAAAAGG - Intergenic
994096779 5:95854368-95854390 GGCCTAAGACCACATGGAGAGGG - Intronic
994246599 5:97485782-97485804 TCCTGCAGACCACAGGGAGAGGG - Intergenic
996124222 5:119706510-119706532 GGTAAAACTCCACAGGGAGAAGG - Intergenic
996289010 5:121829414-121829436 GGGAAAACACCACAAGGAGAAGG - Intergenic
998779350 5:145639339-145639361 GCTTGAAAACCAGAGGGAGAAGG + Intronic
999246704 5:150158879-150158901 TGCTGACCACCCCAGGGTGATGG - Intergenic
999484948 5:151985757-151985779 GGGAAAACACCACAAGGAGAAGG - Intergenic
999870152 5:155741583-155741605 GCCTGAATTCCAAAGGGAGAAGG + Intergenic
1001570079 5:172725145-172725167 GGCTATACACCAAAGGAAGAGGG + Intergenic
1002813772 6:659786-659808 GGTACAACTCCACAGGGAGAAGG + Intronic
1003063081 6:2877307-2877329 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1003527949 6:6913598-6913620 GGCTGGGCACCCCAGGGAGCTGG - Intergenic
1004504658 6:16238403-16238425 GGCTGTACACCTGAGGGGGAAGG + Intergenic
1005072422 6:21874251-21874273 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1006103080 6:31698791-31698813 GGCAGAACACCTCAGGCAGAAGG + Intronic
1006181912 6:32158789-32158811 GGAAGAACCCCCCAGGGAGAAGG + Intronic
1006191588 6:32212910-32212932 GGCTGAACAAGACAGAGACAGGG + Exonic
1006368923 6:33632691-33632713 GTCTGAACAGCAGAGGGAGCAGG - Intronic
1006579953 6:35071490-35071512 GCCTGAATTCCACAGGGAGGAGG + Intronic
1008121528 6:47622402-47622424 GGTAAAACTCCACAGGGAGAAGG - Intronic
1008305254 6:49892023-49892045 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1008450613 6:51646387-51646409 GACTGCACACAATAGGGAGAAGG + Intronic
1009384198 6:63069042-63069064 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1009453100 6:63824832-63824854 GGCAAAACTCCAAAGGGAGAAGG + Intronic
1009500042 6:64401017-64401039 TGCTGAACACCACAGAGATGAGG + Intronic
1010633740 6:78231396-78231418 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1010679257 6:78780888-78780910 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1011133219 6:84073137-84073159 GGAGAAACACCACAGGGAGAAGG - Intronic
1011246928 6:85329281-85329303 GGCAGAACAGCACACGGGGATGG - Intergenic
1012159019 6:95859578-95859600 GGCTGTACAGCTCAGGTAGAGGG + Intergenic
1012428535 6:99141407-99141429 GGCTCAGCATCAGAGGGAGACGG - Intergenic
1013536575 6:111068001-111068023 GGGTGAGCCACACAGGGAGAGGG - Intergenic
1013607349 6:111762460-111762482 GCCTGAACTCCAAAGGGAGGAGG - Intronic
1015434616 6:133172115-133172137 GGCTGAGCACTACATGGAGCTGG + Intergenic
1015663355 6:135600734-135600756 GGATAAATGCCACAGGGAGAAGG - Intergenic
1015788682 6:136944622-136944644 GACTGAAGACCAAATGGAGATGG - Intergenic
1016199365 6:141388893-141388915 GCCTGAATTCCAAAGGGAGAAGG + Intergenic
1016740590 6:147524641-147524663 TTCTAAACTCCACAGGGAGAAGG - Intronic
1016987888 6:149908821-149908843 GGCTCAACACCACATGGAAGCGG - Intergenic
1017177207 6:151516248-151516270 GTCTGAATTCCAAAGGGAGAAGG + Intronic
1017239076 6:152147317-152147339 TTCTGGATACCACAGGGAGAAGG - Intronic
1018622761 6:165747775-165747797 GGCAGAAGCCCACAGGCAGACGG + Intronic
1019014498 6:168870088-168870110 GTCTGAACTCCAAAGGGAGGAGG - Intergenic
1019296247 7:276833-276855 GGCTGCACACCCCAGGTAGCTGG - Intergenic
1020860719 7:13489175-13489197 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1020915179 7:14184219-14184241 GGTAAAACTCCACAGGGAGAAGG + Intronic
1021323843 7:19242824-19242846 GGGGAAAGACCACAGGGAGATGG - Intergenic
1021937837 7:25648710-25648732 GGTTGAGGACCACTGGGAGAAGG - Intergenic
1022184029 7:27949468-27949490 GGCTCAGACCCACAGGGAGAAGG - Intronic
1022777773 7:33545269-33545291 GGTAAAACTCCACAGGGAGAAGG - Intronic
1023159066 7:37279760-37279782 GGTATAACTCCACAGGGAGAAGG + Intronic
1023543152 7:41288323-41288345 GGCTTAACACCACATGTAGGAGG - Intergenic
1023731206 7:43194107-43194129 GCCTGAACTCCAAAGGGAGGAGG + Intronic
1024590638 7:50879776-50879798 GGCTGAAAACCACAGGTTTAGGG + Intergenic
1024754992 7:52518863-52518885 GGCTTAACACCATATGGAAATGG + Intergenic
1025820565 7:64959074-64959096 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026326984 7:69319099-69319121 GGCAGAACCCCACAGGGGCAGGG - Intergenic
1027267003 7:76499995-76500017 GCATGAACATCACAGGGACAAGG - Intronic
1028415813 7:90579583-90579605 GCCTGGACAGCAGAGGGAGACGG - Intronic
1029536246 7:101159493-101159515 GGCTTAACACCAAAGGGTTAAGG + Intronic
1029884286 7:103850525-103850547 GGTAAAACTCCACAGGGAGAAGG + Intronic
1030180873 7:106707780-106707802 GGCTGAATGCCATAGGGATAGGG - Intergenic
1030935919 7:115584977-115584999 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1031090491 7:117348334-117348356 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1035524398 8:301009-301031 GGCTGCAAACCACAGGAGGAGGG + Intergenic
1035542083 8:448103-448125 AGCTGAAGAGAACAGGGAGAGGG + Intronic
1035576376 8:709365-709387 GGCTGAACCCCCCAGGGTGAGGG - Intronic
1035963887 8:4168823-4168845 GGCTGAAGACAACAGAGAGCCGG - Intronic
1036699377 8:11001889-11001911 GGCTGAACAGCAGAGGGACCAGG - Intronic
1037320877 8:17641353-17641375 GGGAAAAGACCACAGGGAGAAGG - Intronic
1037824267 8:22151674-22151696 TACTGAAGACCAGAGGGAGAAGG + Intronic
1039030047 8:33299236-33299258 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1040711604 8:50195504-50195526 GGTATAACTCCACAGGGAGAAGG - Intronic
1040764480 8:50890695-50890717 GGCTGAACATCAGAGGGATATGG - Intergenic
1041260958 8:56020150-56020172 GACTGAGAAGCACAGGGAGAAGG - Intergenic
1041406134 8:57501513-57501535 GCCTAAACCCCAAAGGGAGAGGG + Intergenic
1041570632 8:59333496-59333518 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1042122944 8:65507790-65507812 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1042304198 8:67314331-67314353 GGTAAAACTCCACAGGGAGAAGG - Intronic
1042467212 8:69141218-69141240 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1042995448 8:74693346-74693368 GGGGAAAGACCACAGGGAGAAGG + Intronic
1044476328 8:92630613-92630635 TGGTGAAGACAACAGGGAGAAGG - Intergenic
1044541994 8:93418692-93418714 GGCTACCCACCCCAGGGAGAGGG - Intergenic
1045290825 8:100831259-100831281 GCCTGAACTCCAAAGGGAGGAGG + Intergenic
1045670986 8:104553148-104553170 GGCAAAAAACCACAGGGAGAAGG + Intronic
1045779762 8:105849405-105849427 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1046905204 8:119565259-119565281 GGCAGAACACGCCAGGCAGAGGG + Intronic
1047714206 8:127580693-127580715 GGGAGAACACCACAGGGAATGGG + Intergenic
1047944301 8:129859359-129859381 AGCTCAGCATCACAGGGAGATGG + Intronic
1050502613 9:6314882-6314904 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1051053396 9:12956159-12956181 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1051362616 9:16294525-16294547 GGTGAAACTCCACAGGGAGAAGG + Intergenic
1051505630 9:17824663-17824685 GGATGAACAGCCCAGGGAGAAGG + Intergenic
1053800183 9:41759122-41759144 GCCTGAGCAACATAGGGAGATGG + Intergenic
1053865590 9:42434928-42434950 GGCTTCTCACCACAGGGAAAGGG + Intergenic
1054145010 9:61555713-61555735 GCCTGAGCAACATAGGGAGATGG - Intergenic
1054188611 9:61971274-61971296 GCCTGAGCAACATAGGGAGATGG + Intergenic
1054649910 9:67617343-67617365 GCCTGAGCAACATAGGGAGATGG - Intergenic
1055126074 9:72719254-72719276 GGGAAAAGACCACAGGGAGAAGG - Intronic
1055241923 9:74196875-74196897 GGCTGGGCATCAGAGGGAGACGG - Intergenic
1056322803 9:85452441-85452463 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1056680607 9:88714412-88714434 TGGTGACCAGCACAGGGAGAGGG - Intergenic
1056796294 9:89660948-89660970 GGGTGACCTCCAGAGGGAGAAGG + Intergenic
1057208897 9:93188926-93188948 AGCTCAACACCAAAAGGAGAAGG - Intronic
1057371753 9:94480065-94480087 GGCTGCACTCCTCAGGGAGCAGG - Intergenic
1058623267 9:106905957-106905979 GGTAAAACTCCACAGGGAGAAGG - Intronic
1059321569 9:113474517-113474539 AGCTGAAGACCACAGAGAGAGGG + Intronic
1062743123 9:138192653-138192675 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1062743372 9:138194654-138194676 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1062743621 9:138196655-138196677 GGATGAAGTCCCCAGGGAGAGGG - Intergenic
1203368487 Un_KI270442v1:279182-279204 GGATGAAGTCCCCAGGGAGAGGG + Intergenic
1185619688 X:1446018-1446040 AGCAAAGCACCACAGGGAGAGGG - Intronic
1186314549 X:8355081-8355103 CACTGAACTCTACAGGGAGATGG - Intergenic
1186811924 X:13198673-13198695 GCCTGAACTCCAAAGGGAGGAGG - Intergenic
1187219274 X:17308133-17308155 GGGGAAACACCACAGGGAGAAGG - Intergenic
1187430722 X:19221942-19221964 GGTTAAACTCCACAGGGAGAAGG - Intergenic
1187748317 X:22433269-22433291 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1189383473 X:40518402-40518424 GATTGTACACCACAGGGAAAGGG - Intergenic
1189539497 X:41971395-41971417 GGGAAAAGACCACAGGGAGAAGG + Intergenic
1189603112 X:42648404-42648426 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1189962083 X:46333525-46333547 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1190513291 X:51195725-51195747 GGCTTAACACCACATGGAAGCGG + Intergenic
1190687987 X:52891222-52891244 GCCTGAATTCCATAGGGAGAAGG + Intergenic
1190697995 X:52964570-52964592 GCCTGAATTCCATAGGGAGAAGG - Intronic
1191669440 X:63735421-63735443 TACTCAACACCACAGGCAGAGGG + Intronic
1191779398 X:64849587-64849609 CGGTGAACCTCACAGGGAGATGG - Intergenic
1192820142 X:74636728-74636750 GGAGAAACGCCACAGGGAGAAGG + Intergenic
1192870671 X:75180197-75180219 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1192968245 X:76202741-76202763 GGAAAAACACCCCAGGGAGAAGG - Intergenic
1193062691 X:77223118-77223140 GGTAAAACTCCACAGGGAGAAGG + Intergenic
1193101773 X:77622553-77622575 GGTAAAACTCCACAGGGAGAAGG + Intronic
1193290112 X:79762636-79762658 GGAGAAAGACCACAGGGAGAAGG - Intergenic
1193404190 X:81082241-81082263 GGGAAAAAACCACAGGGAGAAGG + Intergenic
1193631823 X:83899072-83899094 GGAAAAAGACCACAGGGAGAAGG + Intergenic
1193726187 X:85041807-85041829 GGCTCCTCACCACAGGGAAATGG - Intronic
1193779714 X:85686622-85686644 GGTATAACTCCACAGGGAGAAGG - Intergenic
1194095392 X:89632665-89632687 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1194299157 X:92163401-92163423 GGGAAAAGACCACAGGGAGAAGG - Intronic
1194926990 X:99836916-99836938 GGTAAAACTCCACAGGGAGAAGG - Intergenic
1195019539 X:100812825-100812847 GGTGAAACTCCACAGGGAGAAGG - Intergenic
1195232046 X:102859818-102859840 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1196179751 X:112676972-112676994 AATTGGACACCACAGGGAGAGGG - Intronic
1197055557 X:122114196-122114218 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1197664668 X:129210807-129210829 GGGAAAAGACCACAGGGAGAAGG - Intergenic
1198632043 X:138651034-138651056 TGCTGAAAACCATAGGGAGGAGG + Intronic
1199553470 X:149081080-149081102 GGGGAAAGACCACAGGGAGAAGG + Intergenic
1199913656 X:152315425-152315447 GGGAAAATACCACAGGGAGAAGG + Intronic
1200212525 X:154353106-154353128 GGCTGATCACCACCGGGATGGGG + Exonic
1200448022 Y:3288843-3288865 GGGGAAAGACCACAGGGAGAAGG - Intergenic
1200616761 Y:5388235-5388257 GGGAAAAGACCACAGGGAGAAGG - Intronic
1201070210 Y:10141120-10141142 GGATGAAGTCCCCAGGGAGATGG - Intergenic
1201403105 Y:13624279-13624301 GCCTAAACACCAAAGGGAGGAGG - Intergenic
1201756718 Y:17494287-17494309 GGATGAAGTCCCCAGGGAGATGG + Intergenic
1201844835 Y:18411697-18411719 GGATGAAGTCCCCAGGGAGATGG - Intergenic