ID: 1132211446

View in Genome Browser
Species Human (GRCh38)
Location 15:100026085-100026107
Sequence ATGGTAGGAGTCAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132211446_1132211449 -8 Left 1132211446 15:100026085-100026107 CCAACAATTCTGACTCCTACCAT 0: 1
1: 0
2: 2
3: 22
4: 172
Right 1132211449 15:100026100-100026122 CCTACCATCACAGGTTTGTTTGG 0: 1
1: 0
2: 2
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132211446 Original CRISPR ATGGTAGGAGTCAGAATTGT TGG (reversed) Intronic
903916683 1:26769869-26769891 AGGGAAGGAGGCAGAACTGTAGG + Intronic
905318270 1:37097304-37097326 TTGGAAGGAGACAGAATGGTGGG + Intergenic
906670249 1:47649037-47649059 ATGGAGGGAGTCAGGATTGATGG + Intergenic
908219728 1:61993071-61993093 GTGGTGGGAGACAGTATTGTGGG - Intronic
908423680 1:63984192-63984214 ATGGTAGGAGCTAGGAATGTTGG + Intronic
909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG + Intergenic
912638747 1:111323358-111323380 ATGGAGTGAGTGAGAATTGTTGG - Intergenic
914453384 1:147813023-147813045 AAGGGATGAGTCAGAATAGTGGG + Intergenic
915035130 1:152916264-152916286 ATGATATAAGTCAGAAATGTGGG - Intergenic
917663771 1:177203943-177203965 ATGCTGGAACTCAGAATTGTGGG + Intronic
918748618 1:188241176-188241198 ATGGGAGGAGTTTGAGTTGTGGG + Intergenic
922636351 1:227176339-227176361 ATGTTAAGAATCAGAATTCTTGG - Intronic
1063495487 10:6503678-6503700 ATGGTAGGAGTCACAGAAGTGGG - Intronic
1064596855 10:16953984-16954006 ATGGCAGGATTCAGAAATGAGGG + Intronic
1066298287 10:34075288-34075310 ATAGTATGAGTGAGGATTGTTGG - Intergenic
1066561597 10:36675770-36675792 CTGGGAGGAGTCAGACTTGGTGG - Intergenic
1067879745 10:50032999-50033021 ATGGCAGGGGTCAGAAATGTGGG + Intergenic
1081099630 11:38986310-38986332 ATGGTAGTAGTGAGAAGTTTAGG + Intergenic
1081606628 11:44531239-44531261 CTGAAAGGAGCCAGAATTGTGGG + Intergenic
1084592251 11:70097549-70097571 AGGGTAGGAGTGAGCATTGCAGG + Intronic
1084807091 11:71586562-71586584 ATTGTATGAGAGAGAATTGTGGG + Intronic
1087955325 11:104279190-104279212 ATTGTGGGAGTTAGAATTCTAGG - Intergenic
1088077378 11:105867375-105867397 ATGTTAGGACTCAGAATTTTTGG + Intronic
1088119704 11:106353268-106353290 ATGTTAGGAGTGAGAATCTTTGG + Intergenic
1089795733 11:120979559-120979581 ATGGAAGGAGAGAGAAGTGTTGG + Intronic
1094602639 12:31923288-31923310 AGGGTAGGATTCATGATTGTAGG - Intergenic
1095831639 12:46592721-46592743 ATGGAAGGAGTCAGATTTTTAGG + Intergenic
1098357287 12:69623653-69623675 ATGGTAGGAGGAAGAGTTGAAGG - Intergenic
1099738144 12:86597223-86597245 AGGGTAAGAGTCAGAATTACAGG - Intronic
1100699008 12:97126233-97126255 ATTGTGGAAATCAGAATTGTTGG + Intergenic
1104094273 12:125542260-125542282 AGGGTAGAGGTCAGGATTGTTGG + Intronic
1104167703 12:126250057-126250079 ATGGAAGGAGAGAGAATTCTAGG - Intergenic
1104338743 12:127927232-127927254 ATTGTATGAGTCACAATTTTAGG - Intergenic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1111892369 13:94099860-94099882 ATGGCATGAGTTAGAAATGTTGG + Intronic
1113104897 13:106761059-106761081 ATAATAGAAGTCAGGATTGTGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114191833 14:20445313-20445335 AAGGTAAGAGTCAGAATAGGGGG + Intergenic
1116308611 14:43291805-43291827 ATGGTGGGATGCAAAATTGTAGG + Intergenic
1117128429 14:52657765-52657787 ATGGTAGTAATCAGAAAGGTGGG - Intronic
1118510286 14:66464480-66464502 TGGGTAGAAGTCAGAATCGTAGG - Intergenic
1120259728 14:82167267-82167289 ATGGTGGGAGTGAGGATTGGAGG + Intergenic
1121740061 14:96245530-96245552 ATGGTAGTAGTTAGTATTGGAGG - Intronic
1123037583 14:105477785-105477807 GTGGGAGGAGGCAGATTTGTGGG + Intronic
1125397485 15:39265161-39265183 ATGAAAGGAGTCTGAATTGGAGG - Intergenic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1131762207 15:95636527-95636549 ATGCTAAGAGTCAGAACTCTGGG - Intergenic
1132134046 15:99315461-99315483 ATGGTGGGAAACAGAATTCTAGG + Intronic
1132211446 15:100026085-100026107 ATGGTAGGAGTCAGAATTGTTGG - Intronic
1135272045 16:21077903-21077925 AGGGTAGGAGTCAGATTAGGAGG - Intronic
1137682229 16:50358996-50359018 AAGGTTGGAATCAGAATTTTAGG - Intronic
1142773901 17:2120832-2120854 ATGGGAAGTGTCATAATTGTTGG + Intronic
1143564057 17:7710916-7710938 CTGAAAGGAGTCAGAAATGTAGG - Exonic
1146122376 17:30207186-30207208 GTGTTAGGAGTCAGAAGGGTGGG + Intronic
1147333459 17:39712530-39712552 ATGGCAGGAGACAGAAGTGGGGG + Intronic
1148435641 17:47682326-47682348 ATTGTAGGAGTCAGCATTATTGG + Intronic
1149036139 17:52136334-52136356 ATGTTAGGAGACAGACTTGGTGG - Intronic
1150318649 17:64191214-64191236 ATGGTAAGAGTCAGAGATGTGGG - Intronic
1150521934 17:65877530-65877552 ATTGTAGGAGTCTGAAGTGAGGG - Intronic
1151822102 17:76501964-76501986 TTGGCAGGAGTCACAAATGTTGG - Intergenic
1152058197 17:78049301-78049323 ATGGGAGAAGTCAGAATTGCTGG + Exonic
1153260010 18:3214936-3214958 ATGGGAGGAGCCATAATCGTAGG + Exonic
1155735930 18:29222224-29222246 ATGGCAGAAGGCAGAAATGTAGG - Intergenic
1157463316 18:47921670-47921692 ATGAAAGGAGACAGAACTGTGGG - Intronic
1158488127 18:57886612-57886634 GGAGGAGGAGTCAGAATTGTTGG + Intergenic
1158788455 18:60744627-60744649 ATGGTATGACTCACAATTGTAGG - Intergenic
1159995148 18:74957244-74957266 ATGGTAGAACTGACAATTGTAGG - Intronic
1162175119 19:8824611-8824633 ATGGGAGGAGGCAGAAGGGTGGG - Intronic
1162544243 19:11318964-11318986 ATGTTTGGTGTCAGAAGTGTGGG - Intronic
1163070914 19:14840531-14840553 ATGGAAGGAGTCATATTTGTAGG + Intergenic
1163901275 19:20102362-20102384 ATGGTAAGAGCCAGAGTGGTGGG - Intronic
1166655701 19:44610070-44610092 AAGGAAGGAGTCATAATTGTAGG + Intergenic
925919784 2:8630962-8630984 ATGGTGGGACCCAGACTTGTGGG + Intergenic
927120505 2:19956392-19956414 AAGGTAAGAGTCAGACTTCTTGG + Intronic
928378442 2:30798026-30798048 GTGGAAGGAGTCAGAAATTTGGG + Intronic
928499096 2:31869355-31869377 ATGGTAAGAGTCAGAAGTTTCGG - Intronic
930478765 2:51920483-51920505 ATGGTAGGAGGCAGCATTACTGG + Intergenic
930756419 2:54978127-54978149 ATGGAAATAGTCATAATTGTAGG + Intronic
931627567 2:64270745-64270767 ATGGCAGGAGACACATTTGTGGG + Intergenic
932597074 2:73100745-73100767 ATGGCAGGAGTGACAATTCTTGG - Intronic
933184218 2:79260786-79260808 GTGGTGGGACTCAGAATTGGAGG - Intronic
933591138 2:84233862-84233884 ATGGGAAGAATCAGAATTCTGGG - Intergenic
936834030 2:116684907-116684929 CTGTTAGGAATCAGAATTTTGGG - Intergenic
937337432 2:121070587-121070609 ATGTCAGAAGTCAGTATTGTGGG + Intergenic
940042333 2:149373481-149373503 AGGGGAGGAGTCAGAATAGGAGG + Intronic
940511273 2:154618185-154618207 ATGTTAGGATTCACAGTTGTAGG + Intergenic
942864955 2:180662443-180662465 ATGGTTGGAGTCACAAGAGTGGG - Intergenic
943133176 2:183881684-183881706 ATTGTAGGACTCAATATTGTTGG - Intergenic
943252880 2:185552142-185552164 ATGGTGAGAGTCAGAATTTATGG - Intergenic
946409322 2:219508532-219508554 ATTGAAGGAGTCACCATTGTTGG + Intergenic
946898322 2:224347333-224347355 ATTGTATGAGTCACAATTCTTGG - Intergenic
947183034 2:227429026-227429048 ATGCTAGGATTCAGAATCATAGG + Intergenic
948434228 2:237942186-237942208 ATGCTACAAGTCAGACTTGTTGG - Intergenic
1169878865 20:10325671-10325693 ATGGTAGGAGACATGTTTGTTGG - Intergenic
1170058778 20:12237536-12237558 ATGGAAGGAGGCAGCATTTTTGG - Intergenic
1170480428 20:16760091-16760113 ATGGAAGGAGGGAGAATTGGTGG - Intronic
1170588882 20:17756030-17756052 AGGGTAGGAGGCAGAATTGGGGG + Intergenic
1170952726 20:20951528-20951550 ATGGTAGGAGACAGTAGGGTTGG - Intergenic
1171058802 20:21935324-21935346 ATGTAATGAGACAGAATTGTAGG + Intergenic
1172992398 20:39046294-39046316 CTGGTAGGAGGCAGAAATCTGGG + Intergenic
1173551834 20:43937910-43937932 ATGGGAGGAGTCTGGAGTGTGGG + Intronic
1175731612 20:61358077-61358099 ATGTTAGGACTCATAACTGTGGG + Intronic
1181325019 22:22038367-22038389 AGGGCAGGAGTCAGAATAGGTGG - Intergenic
1181733371 22:24863601-24863623 ATGGCAGGAGTCAGAAATGTGGG + Intronic
1185402080 22:50624438-50624460 AAGGCAGGAGACAGAAGTGTGGG + Intronic
949698487 3:6727789-6727811 ATGGAAGTAGAGAGAATTGTGGG + Intergenic
950963162 3:17127300-17127322 GGGGTGGGAGTGAGAATTGTAGG - Intergenic
951992909 3:28695957-28695979 AAGGTAGGAGTCAGAATCAGAGG + Intergenic
952104022 3:30049378-30049400 ATGGTTGGAGTCAGGGTTGGTGG + Intergenic
957424441 3:80020083-80020105 ATGGAAGGTGTCAGTATTGTTGG + Intergenic
959830602 3:110857319-110857341 ATGCTAGGATTCAGATTTATAGG + Intergenic
960215287 3:115026739-115026761 ATGAAAGGAGGGAGAATTGTTGG - Intronic
960397709 3:117157388-117157410 AGAGTGAGAGTCAGAATTGTTGG + Intergenic
961849792 3:129804670-129804692 GTGGTAGTATTCAGATTTGTGGG + Intronic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964223535 3:154371446-154371468 ATTGTAGGAGTCGGAATACTGGG + Intronic
965397847 3:168182048-168182070 ATGGTAGTACTCAGAAGTGCTGG - Intergenic
968645548 4:1738793-1738815 AGGGTAAGAGTCAGAGTGGTGGG + Intronic
970193928 4:13538540-13538562 CTGCTAGGAGTAAGATTTGTGGG + Intergenic
971299873 4:25433263-25433285 GTGGTTGGAGGCAGAAGTGTAGG + Intergenic
972481009 4:39496185-39496207 ATTGTAGGAGAGAAAATTGTAGG + Intergenic
974961394 4:68705569-68705591 ATGGTAGAACACAGAATAGTAGG - Intergenic
975000649 4:69221010-69221032 ATTGTAGGAGCCAGAATACTAGG - Intergenic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
976302908 4:83532162-83532184 ATGGTAGAACTCAGAAGTCTGGG - Intergenic
976721031 4:88168974-88168996 ATGATAGAAGTCAGAATGGATGG - Intronic
978227655 4:106357028-106357050 ATGGTAGCAGTGAAAATTGAAGG - Intergenic
978622472 4:110647298-110647320 ATGGTAGGGTTCAGGATTGGGGG + Intergenic
978970718 4:114801560-114801582 ATGGTAGACATCAGAATGGTGGG + Intergenic
979514643 4:121593753-121593775 GTGCTAGAAGTCAGAATGGTGGG + Intergenic
984159623 4:176235673-176235695 ATGGTATGTGTCAAAATTTTAGG - Intronic
984617329 4:181913565-181913587 AGGGTACGAGTCAGAGTGGTGGG + Intergenic
984919703 4:184752623-184752645 AAGCTTGGAGGCAGAATTGTTGG + Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
990906875 5:60813283-60813305 TTGTTAGCAGTGAGAATTGTGGG - Intronic
990992702 5:61701142-61701164 ATGCCAGGAGACAGGATTGTTGG - Intronic
991187826 5:63831233-63831255 ATTTTAGGAGTCAGAATATTTGG - Intergenic
994236193 5:97365747-97365769 GTGGTAGCAGTGAGAAGTGTGGG + Intergenic
996965619 5:129304544-129304566 AGGGTAGGAGCCAGAGTGGTGGG + Intergenic
997057533 5:130461865-130461887 ATGGTAGAAGATAGATTTGTGGG + Intergenic
998448118 5:142213983-142214005 ATGGTACCAGTCAGAAGTGGTGG - Intergenic
998998733 5:147895811-147895833 AGGGTAAGAGTCAGGAGTGTCGG + Intronic
1001668048 5:173449646-173449668 CTGGTAGGAGACAGAAAAGTGGG + Intergenic
1003992008 6:11495441-11495463 ATGGGTGGAGTCAAAGTTGTAGG + Intergenic
1004720081 6:18261270-18261292 CTGCTAGGATTCAGACTTGTAGG + Intronic
1005276581 6:24225971-24225993 GTGGTAGGAGACAGACTTGTAGG - Intronic
1005819910 6:29589210-29589232 ATGGTAGGAATTAGAATTGGAGG - Intronic
1007669880 6:43543163-43543185 ATGTTAAAAGTCAGAATAGTGGG + Intronic
1009568322 6:65344760-65344782 ATGGTAAATCTCAGAATTGTAGG + Intronic
1010138606 6:72585955-72585977 ATGTTAGAAGTAAGAATTTTGGG - Intergenic
1014203034 6:118625399-118625421 ATGGTAGGAGCCAGAATACTGGG + Intronic
1014380608 6:120736292-120736314 ATGGGAGGAGAGAGAATTATAGG - Intergenic
1014942899 6:127464375-127464397 ATGGTCTGAGTCAGAAGTCTGGG - Intronic
1014953551 6:127588360-127588382 ATAGCAGAAGACAGAATTGTAGG + Intronic
1018456255 6:163955564-163955586 TTGGCAGGAGGCAGAATTGCAGG - Intergenic
1022691667 7:32662271-32662293 ATACTAGGAGGCAGAATTGTAGG - Intergenic
1024290196 7:47797631-47797653 ATGGTTGGAGTCAGGAATGGAGG - Intronic
1024858165 7:53805880-53805902 AGGGTTGGTGTCAGAATAGTTGG - Intergenic
1025859817 7:65316104-65316126 ATGGTTGAATTCAGAATTATGGG + Intergenic
1028024516 7:85820971-85820993 AAGGTAGGAGTGGGAATGGTGGG - Intergenic
1030134973 7:106237921-106237943 AAGGTAGAAGTGAGACTTGTAGG + Intergenic
1030581489 7:111361275-111361297 ATGGTAGCAGTGAGAATAATAGG - Intronic
1033083834 7:138323605-138323627 ATGGTAGTTGTCAGGGTTGTGGG + Intergenic
1033193002 7:139300051-139300073 ATGGCATGATTCAGAATTGATGG - Exonic
1034683425 7:152948563-152948585 ATGGTAGGAGTAATGATAGTAGG - Intergenic
1036527439 8:9548319-9548341 ATTGTAGTAGTCTGAATAGTGGG + Intergenic
1037792662 8:21960044-21960066 CTGATAGGAGACAGAATTGCAGG + Intronic
1040546208 8:48400016-48400038 ATGGAAGAAGTCAGCTTTGTTGG + Intergenic
1042228031 8:66530111-66530133 ACGTTATGAGTCTGAATTGTAGG + Intergenic
1044485768 8:92752376-92752398 ATGGTATGTGTCAGATTTGTGGG + Intergenic
1048378139 8:133840432-133840454 ATGGTAGGAGTCAAATCTGAAGG - Intergenic
1048830789 8:138475262-138475284 AGGGCAGGAGACAGAATTGTGGG - Intronic
1050745323 9:8869539-8869561 CTCCCAGGAGTCAGAATTGTTGG + Intronic
1051112930 9:13660843-13660865 ATGGTGGGGGGCAGAATTGGTGG - Intergenic
1052035752 9:23678601-23678623 ATGGTCAGAGTCAGACTTTTTGG - Intergenic
1052789110 9:32857932-32857954 CTGGTAGAATTCAGAAATGTGGG - Intergenic
1053448351 9:38171022-38171044 AGGGTATGAGTCAGAGTGGTGGG + Intergenic
1055443404 9:76358693-76358715 ATAGGAGGAGTAAGACTTGTTGG - Exonic
1057054811 9:91951918-91951940 TTGGGTGGAGTCAGAAATGTGGG + Intergenic
1057913265 9:99036325-99036347 ATGGATGGAGCCAGTATTGTGGG + Exonic
1058278865 9:103085536-103085558 ATGATAGGAGTCAGAAATTTGGG + Intergenic
1058459062 9:105166021-105166043 ATGGTGGGAGCCAGAAGTGTTGG + Intergenic
1203652457 Un_KI270751v1:140377-140399 ATGGTGGGGGTCAGTCTTGTGGG - Intergenic
1186367574 X:8911385-8911407 ATGGTAGGAGATAGAATTCAAGG - Intergenic
1186607810 X:11110253-11110275 ATTGTGGGAGACAGAACTGTGGG + Intergenic
1189756092 X:44272636-44272658 AAGGCAGGAGTCAGAAGTGAAGG + Intronic
1189949963 X:46218883-46218905 ATTGTAGGAATCAGAAGTTTGGG - Intergenic
1190755249 X:53395872-53395894 TTGGTAGGAGTGGGAATTGAGGG - Intronic
1191133602 X:57040884-57040906 ATGGTAGCAGTCATGACTGTGGG + Intergenic
1194011470 X:88567557-88567579 ATGGCAGGAGTCATAATAGAAGG + Intergenic
1197560059 X:128009968-128009990 AAGGTAGAAGTAAAAATTGTAGG + Intergenic
1197896390 X:131319980-131320002 ATGGTAGGACTCAGAATGGTGGG - Intronic
1198205004 X:134457580-134457602 CTGGAAGGATTCTGAATTGTTGG + Intergenic
1200470044 Y:3575563-3575585 ATGTTAAGAGTAAGAAGTGTAGG - Intergenic
1201639622 Y:16165233-16165255 ATTGTAGGAGCCAGAATAATAGG - Intergenic
1201663191 Y:16420091-16420113 ATTGTAGGAGCCAGAATAATAGG + Intergenic
1201921702 Y:19240647-19240669 ATGGGAGGTGACTGAATTGTGGG + Intergenic