ID: 1132211543

View in Genome Browser
Species Human (GRCh38)
Location 15:100027073-100027095
Sequence CAGGGTGAACAACAGTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132211543 Original CRISPR CAGGGTGAACAACAGTCGGG AGG Intronic
900319800 1:2077024-2077046 CAGGGGGAACAACAGACCTGTGG - Intronic
905530979 1:38678500-38678522 CAGCATGAACAAAAGTCTGGGGG - Intergenic
910217253 1:84854984-84855006 CAGAGTTAACAACAATCTGGTGG + Intronic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
914240822 1:145851609-145851631 CAGGGTGGAGAACAGTGGTGTGG - Intronic
917009037 1:170450155-170450177 CAGGGTGAACAACAATGGCCAGG - Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
1067285468 10:44904564-44904586 AAGGATCAACAACTGTCGGGGGG + Intergenic
1067859572 10:49831652-49831674 CAGCGTGTACACCAGTCAGGAGG - Intronic
1081814211 11:45929573-45929595 CAGGGTGAGCTGCAGTCAGGCGG - Intronic
1083224026 11:61273474-61273496 CAAGGAGCACAACAGTGGGGTGG + Intronic
1083691223 11:64409977-64409999 GAGGGGGAAGAACAGGCGGGAGG - Intergenic
1084732459 11:71082210-71082232 CAGCGTGAACAGCAGCCAGGTGG - Intronic
1086907403 11:92433528-92433550 GAGGGTGAGCAAAAGTAGGGTGG - Intronic
1202806684 11_KI270721v1_random:9340-9362 GAGGGAGAACAACACGCGGGCGG - Intergenic
1091856340 12:3743520-3743542 CAGGGGGATCAACAGCCTGGGGG + Intronic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106358279 13:29005523-29005545 CAGGGTGGAGAGGAGTCGGGAGG + Intronic
1106622056 13:31380157-31380179 TAGTGTGAACAACAGTAAGGTGG - Intergenic
1113017313 13:105841688-105841710 CAGGGTGAAGAACACCCTGGAGG + Intergenic
1115394909 14:32897580-32897602 CACGGTGAATAACAGTCGTAGGG - Intergenic
1117925595 14:60776077-60776099 CAGGTGGAACAACAGTGGAGAGG + Intronic
1122428071 14:101623208-101623230 CAAGGGGAACAACAGTGTGGAGG + Intergenic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1133885609 16:9824856-9824878 CAGCGTGAAAAACAGTGAGGGGG + Intronic
1134504054 16:14791048-14791070 CTGGGTGAAGAACAGGTGGGTGG - Intronic
1134576518 16:15337860-15337882 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1134725925 16:16418639-16418661 CTGGGTGAAGAACAGGTGGGTGG - Intergenic
1134941509 16:18293220-18293242 CTGGGTGAAGAACAGGTGGGTGG + Intergenic
1137601267 16:49757912-49757934 CAGGGGGACCAACAGTGTGGAGG - Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1146073534 17:29706507-29706529 CAGAGTGACCCACAGTAGGGTGG - Intronic
1150812442 17:68367431-68367453 CAGAGTCAACAACATTCTGGTGG - Intronic
1152363100 17:79841397-79841419 CAGGGCGAAGAACTGTCGCGCGG + Intergenic
1157701906 18:49766627-49766649 CAGTAAGAACAACAGTCTGGGGG + Intergenic
1167859532 19:52271507-52271529 CAGGGTCAGCAACAGCCAGGGGG - Intronic
1168309657 19:55454126-55454148 CAGGGTGAGCACCACGCGGGAGG - Intronic
928317973 2:30260463-30260485 GAGTGTGAACATCAGTTGGGAGG + Intronic
931861254 2:66356830-66356852 CAGTGTCAGCAACAGTCAGGTGG - Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
1169428309 20:5513099-5513121 AAGGGAGAACAACAGGCAGGTGG + Intergenic
1170404281 20:16020007-16020029 CAGTGGGAAGAACAGTTGGGAGG - Intronic
1171253377 20:23667704-23667726 GAGGGTGGAGAACAGTCAGGAGG + Intergenic
1171268929 20:23798489-23798511 GAGGGTGGAGAACAGTCAGGAGG + Intergenic
1171280052 20:23888843-23888865 GAGGGTGGAGAACAGTCAGGAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173570998 20:44075978-44076000 CAGGGGGCACAACAGTCACGTGG - Intergenic
1174985131 20:55443191-55443213 CATTGTGAACAACAGTATGGAGG - Intergenic
1175261467 20:57676879-57676901 CAGGGTGGAGAATAGACGGGGGG - Intronic
1176056500 20:63151718-63151740 CAGCATGAAAAACAGTTGGGAGG + Intergenic
1184075310 22:42173363-42173385 CAGGGTCAACATCAGGTGGGGGG + Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
952378681 3:32787714-32787736 CAGGGTGGACAGCAGTCCTGAGG + Intergenic
954968131 3:54628801-54628823 CAGGGGGTACAACAGGCAGGAGG + Intronic
967034725 3:185639555-185639577 CAGTGAGAATAACAGTAGGGGGG + Intergenic
981142207 4:141282113-141282135 CAGGGTGAACTACAGTCAGAAGG + Intergenic
983774998 4:171595248-171595270 AAGAGTGAAGAACAGTAGGGTGG - Intergenic
984328189 4:178280472-178280494 GAGGGTGAATAACAGTCTTGGGG + Intergenic
984451671 4:179911257-179911279 CAGGGTGAAGAATAGTCTGGAGG - Intergenic
990082367 5:51932823-51932845 CAGGATGTACAACAGTGGTGTGG - Intergenic
990476418 5:56165378-56165400 CAGGATGAGCACCAGTGGGGTGG + Intronic
992610672 5:78505565-78505587 CAGGGTGCACAGCAGTCCTGTGG - Intronic
998417358 5:141955589-141955611 CAGGGCCTACAACTGTCGGGAGG - Exonic
999736500 5:154517281-154517303 CAGGCTGAGCCACAGTGGGGAGG - Intergenic
1002539873 5:179899515-179899537 CAGGCTGAATCACAGTCGTGTGG + Intronic
1008614907 6:53217457-53217479 CAGGGTGGACAGCAGTGGTGTGG + Intergenic
1013360896 6:109393187-109393209 CAGGGAGAAAAACAGAGGGGAGG - Intronic
1014780026 6:125554284-125554306 CAAGGTGAACAGCAGACAGGTGG - Intergenic
1024086258 7:45894218-45894240 CAGGGTGAGCAAGAGTTAGGAGG - Intergenic
1026805891 7:73429513-73429535 CAGGGTGGAGAAGCGTCGGGGGG - Intergenic
1027221040 7:76214133-76214155 CAGGGTGAACCACAGCATGGTGG - Intronic
1029274290 7:99395041-99395063 CAGGATGGACAGCAGTGGGGAGG - Exonic
1034319536 7:150167227-150167249 CACAGTGAACAACAGTATGGAGG - Intergenic
1037456273 8:19067578-19067600 AAGGTGGAACCACAGTCGGGTGG + Intronic
1037777857 8:21847595-21847617 CAGAATGACCAACAGTAGGGAGG - Intergenic
1044831055 8:96249672-96249694 CAGTGTGGAGAACAGTCTGGAGG + Intronic
1049757627 8:144317808-144317830 CTGGGTGAAGAACAGCTGGGGGG + Exonic
1051818211 9:21134217-21134239 CAGGGTGAAGAACAGCCTGATGG - Intergenic
1060341430 9:122780123-122780145 CAGAGTGACCAACAGTCGAAGGG - Intergenic
1061835057 9:133323324-133323346 GAGGGTGAACAGGTGTCGGGGGG + Intergenic
1195832803 X:109078024-109078046 CAGGGTGAACCAAAGCAGGGTGG - Intergenic
1198220558 X:134597255-134597277 TAGGGTGAACAACAGAATGGAGG - Intronic