ID: 1132212721

View in Genome Browser
Species Human (GRCh38)
Location 15:100036287-100036309
Sequence CTGTCTTAGGACAGAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132212718_1132212721 -5 Left 1132212718 15:100036269-100036291 CCACACTGGGCAAATTCTCTGTC 0: 1
1: 0
2: 0
3: 17
4: 253
Right 1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 132
1132212714_1132212721 14 Left 1132212714 15:100036250-100036272 CCTGCCGAAGGGCAACGGACCAC 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 132
1132212715_1132212721 10 Left 1132212715 15:100036254-100036276 CCGAAGGGCAACGGACCACACTG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132212721 Original CRISPR CTGTCTTAGGACAGAGGCGC TGG Intronic
901129514 1:6953531-6953553 CTGGCTTAGGACCGAAGCCCAGG + Intronic
901759195 1:11459662-11459684 CTGTGTGAAGACAGAGGCGGAGG - Intergenic
903794954 1:25921773-25921795 CTGTCTCTGGAGAGAGGGGCGGG - Intergenic
904532946 1:31181336-31181358 CTGTTTTTGGACAGGGGGGCAGG + Exonic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
913684160 1:121215647-121215669 CTGTCTTAGATCAGAGGAGATGG - Intronic
914035999 1:144003262-144003284 CTGTCTTAGATCAGAGGAGATGG - Intergenic
917614129 1:176720820-176720842 CTGTCTGAGGCCAAAGGCTCAGG + Intronic
918068760 1:181119656-181119678 CTGGATTAGGACAGTGGCCCAGG + Intergenic
918068925 1:181120896-181120918 CTGGATTAGGACAGTGGCCCAGG - Intergenic
919123071 1:193364937-193364959 CTGTCTTAGGACAGAAGGAAAGG + Intergenic
919273495 1:195382615-195382637 TTCTCTTAGGACAAAGGCCCAGG - Intergenic
920471464 1:206234139-206234161 CTGTCTTAGATCAGAGGAGATGG - Intronic
920681672 1:208077692-208077714 CTGTCTGAGGGCAGAGGCTGGGG + Intronic
923268702 1:232335673-232335695 CTGTCTGGTGACAGAGCCGCAGG - Intergenic
923574351 1:235144325-235144347 CTGCCTGAGGACAGAGGTGGAGG + Intronic
1063373742 10:5539257-5539279 CTGTTTTAGGACAAAAGAGCGGG - Intergenic
1067836763 10:49646299-49646321 CTGGGGTAGGACAGAGGCTCAGG + Intronic
1072918914 10:99559031-99559053 CTGTCATGGGACAGAGGGACTGG - Intergenic
1076442330 10:130488553-130488575 CTGTCTGAGGGCAGAGGCAGGGG + Intergenic
1078069515 11:8099016-8099038 CTGGCCTAGGACAGGGGCTCTGG + Intronic
1078275652 11:9842973-9842995 CTGTCTTAGGAAAAACGTGCAGG + Intronic
1086907963 11:92439254-92439276 CTGTTTTAGATCAGAGGCACTGG - Intronic
1088760644 11:112926054-112926076 CTGTCTTAGCACTCAGGCTCAGG + Intergenic
1089165458 11:116472690-116472712 CTGTTTCAGGACAGAGGGGGTGG - Intergenic
1089470326 11:118715346-118715368 CTGTCTCAGGCCACAGGCCCTGG + Intergenic
1090487343 11:127125733-127125755 CTGTTTCAGGACAGAGGCAGTGG + Intergenic
1091555830 12:1572829-1572851 CTGACTTAGGGCAGTGGCGGTGG + Intronic
1096656951 12:53097903-53097925 CTGTCTCAGGAGGGAGGGGCAGG + Exonic
1096814235 12:54191627-54191649 CGGGCTCAGGACAGAGGGGCTGG - Intergenic
1101071116 12:101076878-101076900 CTGTCTTTGCACAGAGTCCCTGG - Intronic
1102970408 12:117161758-117161780 CTGTCCTAGGGCACAGGTGCAGG + Intronic
1105829341 13:24150151-24150173 GTGTCTCAGGACAGAGGGTCTGG - Intronic
1109860406 13:68190680-68190702 ATGTCTTAGGACAGAGTCCCGGG - Intergenic
1112006125 13:95255302-95255324 CTTTGTAAGGACAGAGGCCCTGG - Intronic
1113830781 13:113294028-113294050 CTGAGTTAGGACAGATGCACAGG - Intergenic
1113889924 13:113730393-113730415 CTGTGTCAGGATAGAGGGGCAGG - Intronic
1117723208 14:58646745-58646767 CTGGCGTAGGGCAGAGGCACAGG - Exonic
1118900611 14:69982490-69982512 CAGGCTTAGGACAGAGGCAATGG + Intronic
1119610574 14:76058288-76058310 CTTTCTTAGGACTGAGACCCTGG - Intronic
1120122623 14:80700382-80700404 CTGTCATAGTACAGAGTGGCAGG + Intronic
1120627773 14:86850417-86850439 CTGTCTTAGGCCAGGTGCGGTGG + Intergenic
1122033209 14:98928634-98928656 GTGGCTCAGGGCAGAGGCGCGGG - Intergenic
1122153721 14:99738133-99738155 CTGACCCAGGACAGAGGGGCAGG + Intronic
1124200753 15:27676969-27676991 CTCCCTTAGGACAGAGAGGCTGG + Intergenic
1124240260 15:28022327-28022349 GAGTCTCAGGACAGAGGGGCGGG - Intronic
1124444588 15:29718717-29718739 CTGTCGTAAGACAGAGGGGCTGG + Exonic
1125327922 15:38555497-38555519 CTGTCTTAGGAGAGAGATCCAGG + Intronic
1130120341 15:81042294-81042316 TTGGCTTAGGCCAGAGGTGCTGG - Intronic
1130909472 15:88261251-88261273 CTGTCTGAGAACAGAGTCGAAGG - Intergenic
1132212721 15:100036287-100036309 CTGTCTTAGGACAGAGGCGCTGG + Intronic
1132352266 15:101147302-101147324 CTGACTCAGGACACAGGCCCTGG + Intergenic
1132598181 16:762607-762629 CTGGCCCAGGACAGAGGCGTGGG + Intronic
1132974704 16:2705519-2705541 CTGGCTTAGGCCACAGGCTCAGG + Intronic
1133060509 16:3171625-3171647 CTGAGTCAGGGCAGAGGCGCTGG + Intergenic
1138819731 16:60244681-60244703 CTGTCTTAGGCCAGACGCAATGG + Intergenic
1140470000 16:75208568-75208590 TTGTCTGAGGACAGAGGGGTTGG + Intergenic
1140844198 16:78871213-78871235 CTGTCTTAGGACAGCAGCGGGGG - Intronic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1141397435 16:83717454-83717476 CTGTCTCAGGAAACAGGCTCAGG + Intronic
1141449284 16:84086552-84086574 CTGTCACAGGACAAAGGCTCAGG + Intronic
1142756705 17:2020806-2020828 CTGTATTAGCCCAGAGGCTCTGG + Intronic
1143009935 17:3860650-3860672 CTGCCTTAGCCCAGAGGAGCCGG + Intronic
1145394762 17:22486435-22486457 CTGGCTTAGGTCAGAGGTCCCGG + Intergenic
1146723250 17:35137877-35137899 CTTTCTTAGGACACAGACACTGG - Exonic
1147520205 17:41163860-41163882 CTGACTGAGGACAAAGGCTCAGG - Intergenic
1147940425 17:44043153-44043175 CTGTCTTAGGAAGGAGGAGCAGG + Intronic
1148784663 17:50140250-50140272 CTGGCTGAGGACAGAGGCAGCGG - Intronic
1150008331 17:61483338-61483360 CTCTCTTGGGAATGAGGCGCTGG - Exonic
1150129514 17:62659723-62659745 CTGTTAGAGGACAGAGGGGCAGG + Intronic
1150578710 17:66453177-66453199 CTGACTTGGAACAGAGGCTCTGG + Intronic
1151176433 17:72292262-72292284 CTGTGTTAGGACAGAGAAGGAGG - Intergenic
1152465762 17:80465185-80465207 CTGTGTTGGGACAGATGGGCAGG + Intergenic
1157306474 18:46521155-46521177 CTGGCCAAGGACAGAGGCGACGG - Exonic
1166523988 19:43499536-43499558 CTGTCTCAGGAGAGAGGGCCTGG + Intronic
927381363 2:22482715-22482737 CTGTCAGAGGACAGGGGCTCTGG + Intergenic
931324643 2:61207238-61207260 TTGTCTTTGGACAGAGACCCTGG - Intronic
934650938 2:96091137-96091159 CTGGCTAAGGACACAGGCCCAGG - Intergenic
937853178 2:126654431-126654453 TTCTCTCAGGACAGAGGAGCGGG + Intergenic
941252296 2:163180908-163180930 CTGCCTTAGGATTGAGGCTCAGG + Intergenic
942401674 2:175609627-175609649 ATGTCTCTGGACAGAGGCTCAGG + Intergenic
946370991 2:219281185-219281207 CTGTCTTTGCCCAGAGGGGCAGG + Intronic
948024760 2:234768184-234768206 CTGTGTGAGGACAGAGGCAGAGG - Intergenic
948894213 2:240920827-240920849 CTGACATAGGAGAGAGGCTCTGG - Intronic
1170741651 20:19063838-19063860 CTCTCCTAGGACAGAGGAGGAGG + Intergenic
1171364286 20:24613239-24613261 CTGTCTTATCTCAGAGGCCCTGG - Intronic
1172539509 20:35699755-35699777 CTGTCTCAGGTGAGGGGCGCGGG + Exonic
1172835307 20:37869561-37869583 CTGTCTAGGGAGAGAGGGGCTGG + Intronic
1173004526 20:39129653-39129675 CTGACTCAGGGCAGAGGTGCTGG - Intergenic
1174196024 20:48773469-48773491 CTGTCTCAGGACAGAACCTCTGG + Intronic
1176075806 20:63247771-63247793 CTGTCCTAGGGGAGAGGTGCAGG + Exonic
1177597763 21:23267660-23267682 CTGTCTTTGGTCAGAGACACTGG + Intergenic
1178913137 21:36692665-36692687 CTGGCTTAGGGCAGGGGCGAGGG + Intergenic
1180037573 21:45257619-45257641 CTGTCCTGGGACAGGGGAGCCGG + Intergenic
1180749284 22:18113279-18113301 GTGGCTCAGGACAGAGGCTCTGG - Intronic
1181579045 22:23816848-23816870 CTGTCTGATGGCAGAGGCGATGG - Exonic
1181629298 22:24142187-24142209 CTCTCTGAGGAGAGAGGCACTGG - Intronic
1183483025 22:38075253-38075275 CTGTGCGAGGACAGAGGAGCAGG - Exonic
1184731064 22:46371353-46371375 CAGTCTGAGGCCAGAGGCACTGG - Intronic
950018325 3:9769505-9769527 CTGTCTTAGGACAGGCGTGTGGG - Intronic
950449406 3:13057283-13057305 CTGTTTTAGGTCAGGGGCTCAGG - Intronic
963188901 3:142447658-142447680 CTGTGTGTGGACAGAGCCGCTGG - Intronic
969652074 4:8473959-8473981 GTGTCTAAGGACTGAGGAGCGGG - Intronic
982216395 4:153086060-153086082 CTGTCTCAGGAGAGAGGAGCTGG + Intergenic
984607933 4:181806288-181806310 CTGTCTCAAGACACAGGCGTGGG - Intergenic
985185603 4:187311854-187311876 GTGTCTTAGGCCTGAGGAGCGGG + Intergenic
986644012 5:9898783-9898805 CTGTCTGTGGACAGGGGTGCAGG - Intergenic
989676921 5:43983224-43983246 CTGTATGAGGACATAGGTGCAGG + Intergenic
992758443 5:79930830-79930852 CTGTTTTAGGACAGATTCCCTGG - Intergenic
996643006 5:125780027-125780049 CTGGCTTATCACAGAGGCTCAGG - Intergenic
1001854253 5:174996978-174997000 CTGTGTGAGGCCAGAGGAGCAGG + Intergenic
1007045852 6:38773604-38773626 CGTTCTTAGCACAGAGGAGCTGG - Intronic
1010399379 6:75430788-75430810 GTGGATTAGGACAGAGGTGCAGG + Intronic
1011818250 6:91219432-91219454 CTGTCTTAGGACATTTGCACAGG - Intergenic
1015812198 6:137171863-137171885 CTGCCGTAGAACAGAGGCACTGG - Intronic
1016383791 6:143511936-143511958 CTGCTTGAGGGCAGAGGCGCTGG - Intergenic
1017328871 6:153172512-153172534 CTACCTTAGGACAGAGGTCCCGG + Intergenic
1018295128 6:162338081-162338103 CTGTACTAGGACAGTGGCCCGGG + Intronic
1018458039 6:163970302-163970324 CAGTCTGAAGAAAGAGGCGCAGG - Intergenic
1022976677 7:35565150-35565172 CTGTCTTAACACAGAGGCAGTGG - Intergenic
1023185037 7:37524326-37524348 ATGCCTGAGGACAGAGGGGCAGG + Intergenic
1023213382 7:37832532-37832554 TTGTCTTGGGGCAGAGGTGCAGG - Intronic
1024752767 7:52487538-52487560 TTGTCCCAGGACAGAGACGCAGG - Intergenic
1032368568 7:131324109-131324131 CTGTCTTACAGCAGAGGTGCAGG - Intronic
1035065189 7:156099252-156099274 CTGTCTTAGCACAAAGCCGGGGG + Intergenic
1035388235 7:158488776-158488798 CAGTCTGAGGACAGATGCGCAGG + Intronic
1038291095 8:26250590-26250612 CTGTATTTGGACAGTGGCCCTGG + Intergenic
1038427188 8:27471383-27471405 TGGTCTTAGGGCAGAGTCGCTGG - Intronic
1042324254 8:67512315-67512337 CTGTCTTGGGTCAGGGGTGCTGG - Intronic
1058629838 9:106975248-106975270 CTTTCTAAGGTCAGAGGCGAAGG - Intronic
1060193438 9:121607672-121607694 CTGTCTAAGGACAGGGGCAGGGG - Intronic
1062013788 9:134281109-134281131 CTGTCTTAGGGCAGAGAGGACGG - Intergenic
1062248980 9:135584668-135584690 CTCTCTGAGGCCAGAGGCCCTGG + Intergenic
1189036236 X:37496070-37496092 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1189037740 X:37509612-37509634 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1196214907 X:113039149-113039171 CTGTCTAAGGACAGAGCCCTGGG - Intergenic
1197747651 X:129943049-129943071 CTGTCTGGGGACAGAGGTGGAGG + Intergenic
1199733664 X:150663191-150663213 CTGCCTGAAGACAGGGGCGCAGG - Intronic
1199808733 X:151328119-151328141 CTCTCTTAGGGCAGAGACACAGG - Intergenic