ID: 1132214911

View in Genome Browser
Species Human (GRCh38)
Location 15:100055354-100055376
Sequence GCTTGTGGCCTGCTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132214911_1132214915 -7 Left 1132214911 15:100055354-100055376 CCAGGCTGGAGCAGGCCACAAGC 0: 1
1: 0
2: 2
3: 13
4: 227
Right 1132214915 15:100055370-100055392 CACAAGCAACAGAGGGTCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 97
1132214911_1132214916 -6 Left 1132214911 15:100055354-100055376 CCAGGCTGGAGCAGGCCACAAGC 0: 1
1: 0
2: 2
3: 13
4: 227
Right 1132214916 15:100055371-100055393 ACAAGCAACAGAGGGTCGCTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
1132214911_1132214917 4 Left 1132214911 15:100055354-100055376 CCAGGCTGGAGCAGGCCACAAGC 0: 1
1: 0
2: 2
3: 13
4: 227
Right 1132214917 15:100055381-100055403 GAGGGTCGCTGGGTAGTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 91
1132214911_1132214918 24 Left 1132214911 15:100055354-100055376 CCAGGCTGGAGCAGGCCACAAGC 0: 1
1: 0
2: 2
3: 13
4: 227
Right 1132214918 15:100055401-100055423 TGGCCTCAGTTCTTGTCTCCAGG 0: 1
1: 0
2: 0
3: 19
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132214911 Original CRISPR GCTTGTGGCCTGCTCCAGCC TGG (reversed) Intronic